ID: 1060110545

View in Genome Browser
Species Human (GRCh38)
Location 9:120903667-120903689
Sequence GATAGGTGTGGGCCACCACC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 4, 3: 69, 4: 277}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060110534_1060110545 30 Left 1060110534 9:120903614-120903636 CCTGACTTGTCTCAGGGTCTTTG 0: 1
1: 0
2: 2
3: 21
4: 229
Right 1060110545 9:120903667-120903689 GATAGGTGTGGGCCACCACCAGG 0: 1
1: 0
2: 4
3: 69
4: 277
1060110541_1060110545 -8 Left 1060110541 9:120903652-120903674 CCTCCAAGGTGAGAAGATAGGTG 0: 1
1: 0
2: 2
3: 9
4: 147
Right 1060110545 9:120903667-120903689 GATAGGTGTGGGCCACCACCAGG 0: 1
1: 0
2: 4
3: 69
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060110545 Original CRISPR GATAGGTGTGGGCCACCACC AGG Exonic
900580539 1:3406452-3406474 TACAGGTGTGAGCCACCACCTGG - Intronic
901039898 1:6357571-6357593 CATGGCTGGGGGCCACCACCTGG + Intronic
902352713 1:15869726-15869748 TACAGGTGTGTGCCACCACGTGG + Intronic
903016568 1:20365830-20365852 GAGGGGTGAGGGCCTCCACCAGG + Intergenic
903414565 1:23173094-23173116 TACAGGTGTGAGCCACCGCCAGG + Intronic
903523279 1:23972131-23972153 CACAGGTGTGAGCCACCACCCGG - Intronic
904200002 1:28813305-28813327 GACAGCTGTGGGCCGCCAACCGG + Intronic
905469553 1:38181603-38181625 TATAGGCGTGAGCCACCACGCGG + Intergenic
905698173 1:39991353-39991375 TACAGGTGTGAGCCACCACCCGG - Intergenic
906088595 1:43157608-43157630 TACAGGCGTGAGCCACCACCCGG - Intergenic
906232782 1:44179938-44179960 TACAGGTGTGAGCCACCACCCGG + Intergenic
906539099 1:46571399-46571421 TACAGGTGTGTGCCACCACCTGG - Exonic
907440025 1:54473241-54473263 GTTAGGGGTGGGCCATCAGCTGG + Intergenic
910247842 1:85161448-85161470 TACAGGCGTGAGCCACCACCTGG - Intronic
910641986 1:89473470-89473492 GGGAGGGGAGGGCCACCACCTGG + Intergenic
911013409 1:93305895-93305917 TACAGGTGTGAGCCACCACATGG - Intergenic
911640136 1:100279636-100279658 TATAGGTGTGAGCCACCATATGG - Intronic
912435751 1:109659955-109659977 GTGAGGTGTGTGGCACCACCTGG + Intronic
912992805 1:114506104-114506126 TATAGGCGTGAGGCACCACCTGG - Intronic
915616551 1:157043872-157043894 CAGAGGCGTGGGCCTCCACCAGG - Intronic
916177179 1:162052115-162052137 TATAGGCATGAGCCACCACCTGG + Intergenic
916548811 1:165830277-165830299 TACAGGTGTGAGCCACTACCTGG + Intronic
916738162 1:167626932-167626954 TACAGGTGTGAGCTACCACCTGG + Intergenic
918376964 1:183918766-183918788 GAAAGGTGAGTGCCACCACCTGG - Intronic
919258850 1:195162793-195162815 CACAAGTGTGTGCCACCACCAGG + Intergenic
920103143 1:203530768-203530790 TATAGTCTTGGGCCACCACCAGG - Intergenic
922482207 1:225946711-225946733 GATAGGTGGGGGCCAATAGCAGG + Intergenic
922951384 1:229560607-229560629 TACAGGTGTGAGCCACCGCCTGG - Intergenic
924411831 1:243813958-243813980 TACAGGTGTGCACCACCACCTGG - Intronic
924662409 1:246033508-246033530 TACAGGTGTGAGCCAGCACCCGG - Intronic
1065013178 10:21437781-21437803 TACAGGCGTGAGCCACCACCCGG + Intergenic
1066067450 10:31772661-31772683 TATAGGCGTGAGCCACCACATGG + Intergenic
1066629281 10:37442882-37442904 TATAGGGGTGAGCCACCACCCGG - Intergenic
1066659563 10:37727024-37727046 TACAGGTGTGAGCCACCACATGG + Intergenic
1069614660 10:69799434-69799456 CATAGGTGGGGGCCAGGACCTGG - Intergenic
1069711576 10:70492730-70492752 TACAGGTGTGAGCCACCACCTGG + Intronic
1069997255 10:72350122-72350144 GACAGGTGTGAGCCACTGCCCGG - Intronic
1070087301 10:73249929-73249951 TATAGGCGTGAGCCACCGCCCGG - Exonic
1070294202 10:75145218-75145240 TACAGGCGTGAGCCACCACCTGG + Intronic
1071091933 10:81929100-81929122 TACAGGTGTGAGCCACCACAGGG + Intronic
1071433612 10:85626116-85626138 GGTAGGTGTGGGGCACCCACTGG + Intronic
1071690399 10:87812536-87812558 TATAGGCGTGAGCCACCACATGG + Intronic
1071805212 10:89111988-89112010 TACAGGTGTGCGCCACCACGTGG + Intergenic
1072451921 10:95545415-95545437 TATAGGTGTGAGCGACCACAGGG - Intronic
1076370769 10:129951678-129951700 GGTGGGTCAGGGCCACCACCAGG - Intronic
1076610583 10:131723541-131723563 CCCAGGTGGGGGCCACCACCAGG - Intergenic
1076927647 10:133500999-133501021 GATAGCTGAGTGCCACCACTTGG + Intergenic
1076986591 11:241105-241127 TACAGGTGTGAACCACCACCTGG + Intronic
1080653290 11:34239604-34239626 TACAGGTCTGAGCCACCACCCGG + Intronic
1080947636 11:36992916-36992938 TACAGGCGTGAGCCACCACCCGG - Intergenic
1081057139 11:38423950-38423972 GATATGTATGGGTCACCAGCAGG - Intergenic
1081092324 11:38887563-38887585 TACAGGTGTGAGCCACCACCTGG + Intergenic
1083407660 11:62469741-62469763 TATAGGTGTGAGCCACTACGTGG + Intronic
1083954376 11:65975376-65975398 TATAGATGTGAGCAACCACCCGG + Intronic
1084181016 11:67445936-67445958 TACAGGTGTGAGCCACCACCCGG + Intergenic
1084224998 11:67710535-67710557 GAATGGTGTGGGCCAGCCCCGGG + Intergenic
1084262817 11:67990378-67990400 GAATGGTGTGGGCCAGCCCCGGG + Intergenic
1084309311 11:68307387-68307409 TATAGGTATGAGCCACCCCCCGG - Intergenic
1085252987 11:75155731-75155753 TACAGGTGTGAGCCACCACGAGG + Intronic
1085284121 11:75349200-75349222 GGGAGGTCTGGGCCACCATCAGG + Intronic
1086958323 11:92957069-92957091 TACAGGTGTGCACCACCACCTGG + Intergenic
1088366005 11:109040613-109040635 TACAGGTGTGAGCCACCACCTGG - Intergenic
1088622322 11:111698464-111698486 TACAGGTGTGAGCCACCACCTGG - Intronic
1090270748 11:125384408-125384430 TACAGGCGTGAGCCACCACCCGG - Intronic
1091321070 11:134652391-134652413 TGTAGGTGTGCACCACCACCTGG + Intergenic
1091504287 12:1051225-1051247 AATTGGTGTGGGCTACAACCTGG + Intronic
1091600879 12:1916990-1917012 GATAGGAGAGGGCCAACTCCAGG - Intronic
1092640892 12:10507731-10507753 TACAGGTGTGTGCCACCACACGG + Intronic
1096580780 12:52583338-52583360 GAGAGGTGTGGACCAACAGCAGG - Intergenic
1097051954 12:56229058-56229080 GGGGGATGTGGGCCACCACCGGG - Exonic
1098337539 12:69419495-69419517 TACAGGTGTGAGCCACCACCTGG + Intergenic
1098716962 12:73841357-73841379 TACAGGTGTGAGCCACCACCCGG - Intergenic
1100817624 12:98401242-98401264 TATAAGTGTGGGCCACTACTGGG - Intergenic
1101542846 12:105680877-105680899 GATGGTTGTGTGCCACCACTTGG - Intergenic
1101991801 12:109491880-109491902 GATACGTTTGGGCCAACCCCGGG - Intronic
1103645418 12:122388492-122388514 TACAGGCGTGAGCCACCACCCGG + Intronic
1103903326 12:124314794-124314816 GTTAGGTGGTGGCCACCCCCAGG + Exonic
1106306176 13:28512443-28512465 TATAGGTGTGAGCCACTGCCCGG + Intergenic
1108392761 13:49963786-49963808 TATAGGTGTGAGCCACCATGCGG - Intergenic
1108844084 13:54657354-54657376 TACAGGTGTGAGCCACCACACGG + Intergenic
1110639170 13:77802188-77802210 TACAGGTGTGAGCCACCACCTGG - Intergenic
1112383886 13:98919811-98919833 GCTGTGGGTGGGCCACCACCTGG - Intronic
1112545469 13:100364906-100364928 TACAGGTGTGCGCCACCACCAGG - Intronic
1113726950 13:112611657-112611679 TATAGGTGTGTGCCACCACAAGG - Intergenic
1114363225 14:21998921-21998943 GATAGGTGTTTGACACTACCAGG + Intergenic
1116254617 14:42535527-42535549 TACAGGTGTGTGCCAACACCCGG - Intergenic
1116438585 14:44923387-44923409 TACAGGTGTGGGCCACCACCTGG - Intergenic
1118263252 14:64268335-64268357 GATAGGTGTGAGCCTCCCCATGG + Intronic
1119362944 14:74067071-74067093 CACAGGTGCGGGCCACCACCTGG - Intronic
1119738257 14:76997776-76997798 TATAGGTGTGAGCCACTGCCTGG - Intergenic
1121284394 14:92724005-92724027 TATAGGTGTGAGCCACCACCCGG + Intronic
1125549069 15:40530850-40530872 TATAGGCGTGCGCCACCACCCGG + Intronic
1125669826 15:41462894-41462916 TATAGGCGTGTGCCACCACCTGG + Intronic
1125819990 15:42621027-42621049 TATAGGGGTGAGCCACCACCTGG + Intronic
1125858558 15:42975169-42975191 TACAGGTGTGAGCCACCACCCGG + Intronic
1125896607 15:43307906-43307928 GATGGGTGTGGCTCACCACCAGG - Intergenic
1126324018 15:47455630-47455652 GATAGGTGAGGACCACTACCAGG - Intronic
1130428565 15:83823349-83823371 GCTAAGTGTGGGGCACTACCAGG + Intronic
1132339323 15:101068069-101068091 GCTTGGGGTGGGGCACCACCAGG + Intronic
1132505312 16:305190-305212 TGTAGGCGTGAGCCACCACCTGG - Intronic
1132559542 16:587141-587163 GTTTGGGGTGAGCCACCACCTGG - Intergenic
1133738332 16:8632479-8632501 TATAGGTGTGAGCCACTACCCGG + Intronic
1133780618 16:8936241-8936263 GATACGCATGGGCCAACACCTGG + Intronic
1134618265 16:15668538-15668560 TATAGGCATGAGCCACCACCTGG + Intronic
1135280359 16:21149086-21149108 TACAGGTGTGCGCCACCGCCTGG - Intronic
1135935255 16:26774510-26774532 TACAGGTGTGTGCCACCACATGG + Intergenic
1136015199 16:27393965-27393987 GACAGGCATGAGCCACCACCTGG - Intergenic
1136054912 16:27681105-27681127 TACAGGTGTGAGCCACCGCCTGG + Intronic
1136489773 16:30599417-30599439 TACAGGTGTGTGCCACCACCTGG + Intergenic
1137265303 16:46864280-46864302 TACAGGTGTGAGCCACCTCCTGG - Intergenic
1138425280 16:56927977-56927999 TACAGGTGCGAGCCACCACCTGG - Intergenic
1138498975 16:57426782-57426804 TATAGGTGTGAGCCACTGCCTGG - Intergenic
1138634645 16:58328020-58328042 TAAAGGCGTGTGCCACCACCTGG - Intronic
1140184215 16:72752244-72752266 TACAGGCGTGAGCCACCACCTGG + Intergenic
1141146624 16:81535223-81535245 TACAGGTGTGAGCCACCACGTGG + Intronic
1141441652 16:84033287-84033309 GCAAGGTGGGGGCCCCCACCAGG + Intronic
1142341344 16:89524845-89524867 GGTTGGTGTGGCCCACCCCCGGG + Intronic
1142729281 17:1840559-1840581 TACAGGCGTGAGCCACCACCTGG + Intronic
1143615823 17:8048505-8048527 GGTAGGTGTAGGGCAGCACCAGG - Exonic
1143704317 17:8686636-8686658 TACAGGTATGAGCCACCACCCGG + Intergenic
1144563183 17:16338671-16338693 TACAGGTGTGTGCCACCCCCTGG - Intronic
1144697198 17:17312992-17313014 TACAGGTGTGAGCCAGCACCCGG - Intronic
1146110692 17:30086468-30086490 TACAGGTGTGAGCCACCACCTGG - Intronic
1147610435 17:41798885-41798907 TATAGGAATGAGCCACCACCAGG - Intergenic
1147912666 17:43865515-43865537 TACAGGTGTGAGCCACCACGCGG + Intergenic
1148221213 17:45863720-45863742 TACAGGTGTGAGCCACCAACAGG + Intergenic
1148944574 17:51248973-51248995 TATAGGTGTGAGCCACCATGCGG - Intronic
1149320865 17:55479307-55479329 GATAGGCGTGAGCCACCACACGG - Intergenic
1149870007 17:60172566-60172588 TACAGGTGTGAGCCACCACACGG - Intergenic
1150077842 17:62208331-62208353 GACAGGTAAGAGCCACCACCCGG + Intergenic
1151515660 17:74593546-74593568 TACAGGCGTGTGCCACCACCTGG - Exonic
1151848279 17:76673378-76673400 GATGACTGTGGGCCTCCACCAGG + Exonic
1151901006 17:77015026-77015048 TACAGGTGTGAGCCACCGCCTGG - Intergenic
1152194697 17:78910466-78910488 TAAAGGTGTGGGCCACCGCCTGG + Intronic
1152612490 17:81322644-81322666 GACAGGCGTCGGCCACCACCCGG - Intronic
1152687067 17:81699797-81699819 TATAGGCGTGAGCCACCGCCCGG - Intronic
1153396806 18:4631438-4631460 GATAGTTTTCTGCCACCACCAGG - Intergenic
1153687781 18:7564071-7564093 TACAGGTGTGAGCCACCACATGG + Intergenic
1158241193 18:55380155-55380177 TACAGGTGTGAGCCACCACGAGG + Intronic
1158708849 18:59818949-59818971 GATAGGTGCAGGAAACCACCAGG + Intergenic
1159511436 18:69401456-69401478 GGCAGGTGTGGGCCCCCACCTGG - Intronic
1160511992 18:79457956-79457978 GACAGGTGTGGGCAGCCACACGG - Intronic
1160980779 19:1815725-1815747 CAGAGGTGCCGGCCACCACCCGG + Exonic
1160989708 19:1855501-1855523 GGCAGGGGCGGGCCACCACCCGG + Intronic
1161080792 19:2309010-2309032 GACAGGTGTGAGCCACCGCCCGG + Intronic
1162137678 19:8565811-8565833 GACAGGTGTGAGCCACCACCCGG - Intronic
1163589459 19:18183649-18183671 GACAGATCTGAGCCACCACCTGG + Intergenic
1163765254 19:19160243-19160265 TACAGGTGTGAGCCACCACACGG + Intronic
1164454476 19:28395805-28395827 TACAGGTGTGCACCACCACCTGG - Intergenic
1165322944 19:35097408-35097430 TACAGGTGTGCACCACCACCAGG - Intergenic
1166084965 19:40468353-40468375 TATAGGCGTGAGCCACCGCCTGG + Intronic
1166395594 19:42438081-42438103 TACAGGTGTGAGCCCCCACCTGG - Intronic
1168045331 19:53790221-53790243 TATAGGCGTGAGCCACCACGTGG + Intergenic
1168697630 19:58413774-58413796 TACAGGCGTGAGCCACCACCCGG + Intronic
1168708654 19:58484554-58484576 TACAGGTGTGAGCCACCACATGG - Intronic
925126490 2:1461049-1461071 GACAGTTGGGGGCCACCATCTGG + Intronic
925792899 2:7510800-7510822 CACAGCTGTGGGCCACCACATGG - Intergenic
926704835 2:15829651-15829673 TATAGGCATGAGCCACCACCAGG - Intergenic
927892433 2:26760223-26760245 AACAGGTGTGAGCCACCACACGG + Intergenic
928895246 2:36254639-36254661 TACAGGTGCGTGCCACCACCTGG + Intergenic
929578329 2:43066649-43066671 GTGAGCTGGGGGCCACCACCGGG + Intergenic
929600051 2:43199273-43199295 TACAGGTGTGAGCCACCACGGGG + Intergenic
930638786 2:53834423-53834445 TACAGGCGTGGGCCACCGCCCGG - Intergenic
931821539 2:65957032-65957054 GACAAGTAAGGGCCACCACCAGG + Intergenic
931870744 2:66456797-66456819 GATGAGTGTGGGCCTCCATCAGG + Intronic
932612728 2:73211740-73211762 TACATGTGTGAGCCACCACCCGG + Exonic
935321185 2:101890899-101890921 TACAGGTGTGTGCCACCACATGG + Intronic
935759792 2:106310374-106310396 TACAGGTGTGAGCCACCGCCTGG + Intergenic
936096968 2:109537804-109537826 GTTAGGTGTGGATCTCCACCTGG + Intergenic
936767829 2:115875358-115875380 GAGAAGTGTGGGCCACCACTGGG - Intergenic
937350253 2:121155949-121155971 GATGGGTGTGAGCCTCCACCAGG + Intergenic
937917559 2:127106481-127106503 GAGAGCTGAGGGTCACCACCTGG + Intronic
938033249 2:128013787-128013809 TACAGGTGTGAGCCACCACATGG - Intronic
942267022 2:174238351-174238373 TATAGGCATGCGCCACCACCAGG - Intronic
942426674 2:175867712-175867734 TACAGGTGTGAGCCACCATCCGG - Intergenic
942438721 2:176009095-176009117 TACAGGTGTGAGCCACCACGTGG - Intergenic
944510984 2:200465755-200465777 TACAGGTGTGAGCCATCACCTGG - Intronic
946209152 2:218133572-218133594 TACAGGTGTGAGCCACCACTGGG + Intronic
947782965 2:232786510-232786532 TATAGGCGTGAGCCACCACGCGG + Intronic
1174254587 20:49245020-49245042 GAAAGCTGTGGGGCCCCACCTGG + Intronic
1174623757 20:51897281-51897303 TACAGGTGTGCACCACCACCTGG - Intergenic
1174663363 20:52235003-52235025 GATAGGTGTGGGCACCCAAGAGG + Intergenic
1175905196 20:62376222-62376244 TACAGGTGTGAGCCACCGCCTGG + Intergenic
1178061820 21:28861235-28861257 GATAGTTGAGTGCCACCACTTGG - Intergenic
1178444318 21:32624750-32624772 TATAGGCGTGAGCCACCACCTGG + Intergenic
1179534844 21:42044933-42044955 GACAGGTGTGAGCCACATCCTGG + Intergenic
1179811115 21:43870434-43870456 TACAGGTGTGAACCACCACCCGG - Intronic
1179923860 21:44521960-44521982 TGAAGGTGTTGGCCACCACCAGG + Exonic
1181269299 22:21649680-21649702 GATATGGGTGGGGCACCAACAGG + Intergenic
1181453203 22:23037750-23037772 GAGAGGGGTGCGTCACCACCTGG - Intergenic
1181902350 22:26167099-26167121 GCTCGGTGTGGGACAGCACCTGG + Intergenic
1181906749 22:26203714-26203736 GAGAGGTGTTGGACACGACCAGG + Intronic
1182507363 22:30793717-30793739 TATAGGTGTGCACCACCACGTGG - Intronic
1183069173 22:35384357-35384379 TAGAGGTGTGAGCCACCACCCGG + Intronic
1183159416 22:36101808-36101830 TATAGGTGTGAGCCACCATCCGG + Intergenic
1183422608 22:37720786-37720808 TACAGGTGTGAGCCACTACCAGG + Intronic
1183555292 22:38521426-38521448 TATAGGTGTGAGCCACCACAAGG - Intronic
1183706784 22:39479196-39479218 TACAGGTGTGTGCCACCACTCGG - Intronic
1183977107 22:41518656-41518678 TACAGCTGTGAGCCACCACCCGG - Intronic
1184042109 22:41950420-41950442 TACAGGCGTGAGCCACCACCTGG - Intergenic
1184085599 22:42261716-42261738 TACAGGTGTGAGCCACCATCTGG - Intronic
1184791322 22:46701903-46701925 GACAGGCGTGAGCCACCGCCCGG - Intronic
1185396195 22:50590833-50590855 TACAGGTGTGTGCCACCACCTGG + Intronic
949262027 3:2114175-2114197 TACAGGTGTGAGCCACCACCTGG - Intronic
949307488 3:2659184-2659206 TACAGGTCTGAGCCACCACCTGG - Intronic
950139348 3:10604471-10604493 GATAGCTGGGGGCCAAGACCTGG - Intronic
950441590 3:13014010-13014032 CACAGGTGTGGGCAGCCACCTGG + Intronic
950477513 3:13223384-13223406 GATAGGAGCGCGCCACCTCCTGG + Intergenic
952309078 3:32170831-32170853 CACAGGTGTGTGCCACCACTGGG - Intergenic
953643720 3:44733582-44733604 CAAAGGTGAGGGCCAGCACCTGG + Intronic
954071541 3:48146482-48146504 TACAGGTGTGAGCCGCCACCTGG + Intergenic
954418397 3:50405474-50405496 GCTGGGTTTGGGCAACCACCTGG + Intronic
954956627 3:54526964-54526986 TACAGGTGTGAGCCACCACGTGG + Intronic
955742959 3:62111722-62111744 TATAGGCGTGAGCCACCACCGGG + Intronic
955916873 3:63915208-63915230 TACAGGTGTGAGCCACCGCCTGG + Intronic
956395648 3:68823515-68823537 GATAGGTGTAGTGAACCACCAGG - Intronic
957078254 3:75618320-75618342 GAATGGTGTGGGCCAGCCCCGGG + Intergenic
960727728 3:120687421-120687443 TATAGGCGTGAGCCAGCACCTGG + Exonic
961632628 3:128312487-128312509 GTTTGGTGTGGGCACCCACCGGG + Intronic
963739927 3:149067866-149067888 TATAGGTGTGAGCCACCAGCAGG - Intronic
963785442 3:149530070-149530092 TACAGGTGTGAGCCACCGCCCGG - Intronic
963946589 3:151152375-151152397 TACAGGTGTGAGCCACCGCCTGG + Intronic
965527662 3:169738773-169738795 TACAGGCGTGAGCCACCACCTGG + Intergenic
966842869 3:184103654-184103676 TACAGGTGTGTGCCACCATCTGG - Intronic
967022078 3:185531603-185531625 TACAGGTGTGAGCCACCAGCTGG - Intronic
967246203 3:187489650-187489672 TACAGGTGTGTACCACCACCTGG + Intergenic
968192091 3:196675925-196675947 GACAGGCGTGAGCCACCACCTGG + Intronic
968804875 4:2765945-2765967 TACAGGTGTGAGCCACCGCCTGG + Intergenic
968841408 4:3009145-3009167 TATAGGCGTGAGCCACCACCCGG - Intronic
969057495 4:4410996-4411018 TATAGGTGTGCGCCACCACCCGG + Intronic
969732538 4:8965123-8965145 GAATGGTGTGGGCCAGCCCCGGG - Intergenic
969792117 4:9499206-9499228 GAATGGTGTGGGCCAGCCCCGGG - Intergenic
970877094 4:20884288-20884310 GATAGGTGCAGGAAACCACCAGG - Intronic
971330669 4:25678654-25678676 CACAGGCGTGAGCCACCACCAGG + Exonic
971390702 4:26182772-26182794 TACCGGTGTGAGCCACCACCCGG + Intronic
972624237 4:40780464-40780486 CACAGGTGTGTGCTACCACCTGG - Intronic
973271015 4:48263436-48263458 TACAGGTGTGAGCCACCGCCTGG - Intronic
974121004 4:57639213-57639235 AATAGTTGTGGGAAACCACCTGG - Intergenic
974297831 4:60025577-60025599 TACAGGTGTGAGCCACCACCTGG + Intergenic
975330164 4:73103947-73103969 GAAAAGTTTGGCCCACCACCAGG + Intronic
975542438 4:75528771-75528793 TACAGGTATGAGCCACCACCCGG - Exonic
975547058 4:75570675-75570697 TACAGGTGTGTGCCACCACATGG - Intergenic
975705019 4:77103164-77103186 TATAGGTGTGAGCCACCACGCGG + Intergenic
979225225 4:118277445-118277467 GCTAGGCGTGTGCCACCACTTGG - Intergenic
980018051 4:127676308-127676330 TATAGGTGTGAGCCACTGCCTGG - Intronic
980340687 4:131541734-131541756 GAAAGGTGTGGCCCAGAACCTGG + Intergenic
983565439 4:169145721-169145743 TACAGGTGTGAGCCACCGCCTGG + Intronic
983565479 4:169146501-169146523 TACAGGTGTGAGCCACCACCCGG + Intronic
983796348 4:171868820-171868842 TACAGGCGTGGGCCCCCACCTGG + Intronic
984779848 4:183515135-183515157 GAGAGGTGTGGAGCATCACCTGG + Intergenic
985822367 5:2169032-2169054 GATCGGGGTGGGCCACACCCAGG + Intergenic
987304627 5:16625685-16625707 GAAAGGTGTGGGCCACAGCCAGG - Intergenic
987368194 5:17168886-17168908 TATAGGTGTGAGCCTGCACCTGG + Intronic
987378516 5:17260898-17260920 TACAGGTGTTAGCCACCACCAGG - Intronic
987664474 5:20919424-20919446 TACAGGTGTGAGCCACCACCCGG - Intergenic
988705008 5:33717160-33717182 GAGAGGTGTGGGGCACAACAGGG + Intronic
988758207 5:34282768-34282790 TACAGGCGTGAGCCACCACCCGG + Intergenic
989024500 5:37050968-37050990 TACAGGTGTGCGCCACCACCTGG + Intronic
989180076 5:38567802-38567824 TATAGGCATGAGCCACCACCTGG + Intronic
990368594 5:55094506-55094528 GATGGGAGTGGGCCAACCCCTGG - Intergenic
990845533 5:60134362-60134384 CACATGTGTGGGCCACCACCTGG - Intronic
992902156 5:81307852-81307874 TACAGGTGTGTACCACCACCTGG - Intronic
993823310 5:92648107-92648129 GATACTTGTGGGACATCACCAGG + Intergenic
994516606 5:100780227-100780249 GAGAGGTGAGGGCCACCTCAGGG + Intergenic
994702327 5:103150628-103150650 TACAGGTGTGAGCCACCACAAGG - Intronic
995792082 5:115899561-115899583 TACAGGTGTGAGCCACCACCTGG + Intronic
1000298580 5:159934523-159934545 TATAGGAGTGAGCCACCACCTGG - Intronic
1000332964 5:160220332-160220354 TACAGGTGTGAGCCATCACCTGG - Intronic
1000635282 5:163636996-163637018 GACATGTGTGGGGCACCCCCTGG + Intergenic
1001387349 5:171350790-171350812 TACAGGCGTGAGCCACCACCTGG + Intergenic
1001844014 5:174904663-174904685 GAGAGGAGAGGGCCACCACCTGG + Intergenic
1005384799 6:25275253-25275275 TATAGGTGTGTGCCACCACATGG - Intergenic
1005561870 6:27048710-27048732 TACAGGTGTGAGCCACCATCTGG + Intergenic
1005909255 6:30293903-30293925 GATGGGTTCTGGCCACCACCTGG + Intergenic
1007574119 6:42913900-42913922 CACAGGCGTGCGCCACCACCTGG - Intergenic
1007850961 6:44802421-44802443 TATAGGTGTGAGCCTGCACCTGG + Intergenic
1011255249 6:85414135-85414157 TATAGGCATGCGCCACCACCAGG + Intergenic
1011635958 6:89373475-89373497 TACAGGTGTGCGCCACCACGTGG - Intronic
1012850961 6:104446338-104446360 GAGAGGTGCGGGCCAGAACCGGG + Intergenic
1012903257 6:105032447-105032469 TAAAGGTGTGAGCCACCACACGG - Intronic
1013061206 6:106635728-106635750 TACAGGCGTGTGCCACCACCTGG - Intronic
1013213484 6:108007025-108007047 TACAGGTGTGAGCCACCGCCTGG + Intergenic
1013298220 6:108779184-108779206 TACAGGCGTGAGCCACCACCTGG - Intergenic
1017345258 6:153372146-153372168 TATAGGCATGAGCCACCACCTGG - Intergenic
1018273505 6:162105540-162105562 TACAGGCGTGTGCCACCACCTGG + Intronic
1018283739 6:162215768-162215790 CACAGGTGTGAGCCACCGCCCGG - Intronic
1018949367 6:168369175-168369197 GATGGGTGTGGGCAGCCACCAGG - Intergenic
1019204751 6:170350526-170350548 GGTGGGTGTGGGCCAGCAACAGG + Intronic
1020025402 7:4896202-4896224 TAAAGGTGTGAGCCACCACCTGG - Intergenic
1020890271 7:13869468-13869490 TACAGGTGTGAGCCACCACCTGG + Intergenic
1021823377 7:24520015-24520037 GATAAGTGGAGGCCATCACCCGG + Intergenic
1022015329 7:26344442-26344464 TACAGGTGTGAGCCACCACCTGG + Intronic
1022785217 7:33631623-33631645 GATGAGTCTGGGCCACCACTGGG - Intergenic
1025992950 7:66509622-66509644 TATAGGTGTGAGCCACCACATGG - Intergenic
1025997520 7:66537386-66537408 TACAGGTGTGTGCCACTACCTGG - Intergenic
1026196513 7:68178131-68178153 TATAGGTGTGTGCCACCACATGG + Intergenic
1026676150 7:72430094-72430116 TACAGGTGTGAGCCACCGCCCGG + Intronic
1026838370 7:73653287-73653309 TACAGGTGTGTACCACCACCCGG + Intergenic
1028232123 7:88318407-88318429 GAAGGGTGTGGGCCACTACAGGG - Intergenic
1029479560 7:100804274-100804296 TACAGGCGTGAGCCACCACCTGG + Intronic
1029661703 7:101966691-101966713 GACAGGTGAGGGCCACCTGCAGG + Intronic
1032052815 7:128659450-128659472 TATAGGTATGAGCCACCACTAGG - Intergenic
1033358570 7:140621308-140621330 TACAGATGTGAGCCACCACCAGG + Intronic
1034631716 7:152536174-152536196 TACAGGCGTGAGCCACCACCCGG - Intergenic
1039042910 8:33425058-33425080 TACAGGTGTGAGCCAGCACCCGG - Intronic
1039214453 8:35253762-35253784 TATAGGTGTGAGCCACCACGTGG + Intronic
1039446411 8:37636710-37636732 CACAGGTGTGTGCCACCACGTGG - Intergenic
1039795039 8:40905744-40905766 TATAGGTGCAGGCCACCACATGG + Intergenic
1039864795 8:41491025-41491047 GAAGGGTGTGGGCGACAACCGGG + Intronic
1040015575 8:42696441-42696463 GATAGGTCTTGGCTCCCACCTGG + Intergenic
1041971345 8:63746584-63746606 GAAAGGTGTGGGACACTGCCAGG - Intergenic
1042499330 8:69491674-69491696 CATAGGTGAGAGCCACCACATGG - Intronic
1044150565 8:88771271-88771293 GATAGTTGAGTGCCACCACTTGG - Intergenic
1045461523 8:102429732-102429754 CACAGGTGTGAGCCAACACCCGG + Intergenic
1047387015 8:124419629-124419651 TAAAGGTGTGCGCAACCACCCGG + Intergenic
1048010364 8:130450494-130450516 TATAGGTGTGAGCCACCACACGG + Intergenic
1049280095 8:141739900-141739922 GAGAGGTGGGGGCCATGACCCGG + Intergenic
1049501840 8:142971308-142971330 GACAGGTGAGGGGCAGCACCTGG + Intergenic
1050617851 9:7421204-7421226 TACAGGTGTGTGCTACCACCTGG + Intergenic
1050818236 9:9842755-9842777 GGACTGTGTGGGCCACCACCTGG - Intronic
1051103157 9:13546129-13546151 TACAGGTGTGAGCCACCACCCGG - Intergenic
1052152022 9:25128865-25128887 TACAGGTGTGAGCCACCGCCCGG + Intergenic
1052371284 9:27667701-27667723 TATAGGTGTGCCACACCACCTGG + Intergenic
1052805996 9:33013885-33013907 GACAGGTGGGGGCAACCACCAGG + Intronic
1052974305 9:34400378-34400400 GATGGGTGAGGGGCACTACCCGG + Exonic
1053215499 9:36266923-36266945 TACAGGCGGGGGCCACCACCCGG - Intronic
1056290025 9:85133926-85133948 TACAGGTGTGAGCCACTACCTGG - Intergenic
1057474520 9:95387348-95387370 TATAGGTGTGTGCCACCACTCGG + Intergenic
1058587865 9:106530007-106530029 TACAGGTGTGTGCCACCACCAGG - Intergenic
1059244527 9:112838163-112838185 TACAGGTATGAGCCACCACCAGG + Intronic
1060110545 9:120903667-120903689 GATAGGTGTGGGCCACCACCAGG + Exonic
1060183105 9:121547318-121547340 TACAGGTGAGTGCCACCACCCGG + Intergenic
1060379472 9:123153464-123153486 TACAGGTGTGAGCTACCACCCGG + Intronic
1060438345 9:123615657-123615679 GAGAGGTGTTAGCCACCACTGGG - Intronic
1060491463 9:124088275-124088297 GACAGGTGTGAGCCACTGCCTGG + Intergenic
1060597590 9:124857507-124857529 CACAGGTGTGGGCCACATCCAGG - Exonic
1060656447 9:125375560-125375582 TACAGGTGTGAACCACCACCCGG - Intergenic
1061328412 9:129877929-129877951 TACAGGTGTGTGCCACCACCTGG - Intronic
1062436680 9:136549434-136549456 CCTGGGTGGGGGCCACCACCAGG + Intergenic
1062516918 9:136941482-136941504 GCTAGGTGTGGGCCGCCTGCGGG + Intronic
1203770197 EBV:46033-46055 GATAGGAGTGGGCCATCAAAAGG + Intergenic
1186642493 X:11471037-11471059 GAAAGGTTTGGCCCACCACAAGG + Intronic
1188400537 X:29738713-29738735 TACAAGTGTGAGCCACCACCTGG + Intronic
1190026407 X:46927670-46927692 TACAGGTGGGAGCCACCACCTGG + Intronic
1190048872 X:47134299-47134321 CACAGGTGTGCGCTACCACCTGG + Intergenic
1190327915 X:49218172-49218194 GAGACGTGTGGGCATCCACCAGG + Intronic
1192305747 X:69957736-69957758 AATAGGTGTGGGACATCTCCGGG - Intronic
1192838282 X:74825826-74825848 TACAGGTGTGAGCCACCACCCGG + Intronic
1196843257 X:119878189-119878211 TACAGGTGTGAGCCACCGCCCGG - Intergenic
1198845034 X:140901341-140901363 TACAGGTGTGAGCCACCGCCTGG - Intergenic
1200108177 X:153725758-153725780 GGTAGGCGTGGGCCACCAGACGG - Exonic