ID: 1060110989

View in Genome Browser
Species Human (GRCh38)
Location 9:120906050-120906072
Sequence CTGGGGAAACAGGTGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 674
Summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 614}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060110989 Original CRISPR CTGGGGAAACAGGTGGGGCA GGG (reversed) Intronic
900216840 1:1486246-1486268 CTGGCTGAACAGGTGGGCCAGGG + Intronic
900223921 1:1523975-1523997 CTGGCTGAACAGGTGGGCCAGGG + Intronic
900251880 1:1675192-1675214 GTGGGGAGACAGGTGGGGGCTGG - Intronic
900262291 1:1738048-1738070 GTGGGGAGACAGGTGGGGGCTGG - Intronic
900578084 1:3394112-3394134 TTGGGGGAAGAGGTGGGGGAAGG + Intronic
900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG + Intronic
901037863 1:6347125-6347147 CTGGGGCCCTAGGTGGGGCAGGG - Intronic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
901305044 1:8226767-8226789 CTGGGGACACAGGGGGGCCCAGG + Intergenic
902042393 1:13502386-13502408 CTGGGGAAGCAAGTGGGGGCAGG - Intronic
902047407 1:13536061-13536083 GAAGGGAAATAGGTGGGGCATGG + Intergenic
902340744 1:15782119-15782141 ATGGGGAAACTGGTGGGGTGTGG + Intronic
902554715 1:17240152-17240174 CTGTGGGAACAGGTGAAGCAAGG + Intronic
902585456 1:17436567-17436589 CTGGAGACAGAGGTGGGCCAGGG + Intronic
903015975 1:20362042-20362064 CTGTGGAAAGAGGAGTGGCAGGG + Intergenic
903278089 1:22234102-22234124 CTGGGGAAACTGGTGGGGGAGGG - Intergenic
903461963 1:23526511-23526533 CGGGGGAGACAGGTGTGGCTGGG - Intronic
903499949 1:23795280-23795302 GTGGGGAAACAGCTGAGGGAAGG - Exonic
903515621 1:23909008-23909030 CAGTGGAAGCAGGTGGGGGAGGG + Intronic
904470948 1:30735898-30735920 ATGGGCACATAGGTGGGGCAAGG + Intronic
904752833 1:32751638-32751660 CTGGGGGAAGAGGGGGTGCAAGG + Intronic
904839617 1:33363995-33364017 GTGGGGGAGCAGGTGGGGGAGGG - Intronic
905402904 1:37716296-37716318 CTGCAGAAACAGCTGGGGTAGGG + Exonic
905821081 1:40991986-40992008 TTGGGGAACCAGGAGAGGCAGGG - Intronic
906074965 1:43045403-43045425 GTGTGGAAACAGATGGGGTATGG + Intergenic
906237337 1:44219922-44219944 CTGTGGATATAGGTTGGGCAGGG + Intronic
906506438 1:46383230-46383252 TTTGGGAAAGAGGAGGGGCAGGG + Intergenic
906616164 1:47234267-47234289 CTGAGGAAACAGCTGGACCAAGG + Intergenic
906838060 1:49105399-49105421 CAGCTGTAACAGGTGGGGCATGG - Intronic
907846093 1:58208317-58208339 TTGGGGAAACAGGTGGTGTCTGG + Intronic
908490798 1:64642233-64642255 CTGAAAAAAAAGGTGGGGCAGGG - Intronic
909259961 1:73474776-73474798 CTTGGGAAACAGAGTGGGCAAGG + Intergenic
909643254 1:77889190-77889212 CTGGGGCAAGTGGTGGGGGACGG - Intronic
910981736 1:92965091-92965113 CAGAGGAAACAGGAGTGGCAGGG - Intergenic
911370307 1:96988086-96988108 CTGGGAACACAGATGGGGAAGGG - Intergenic
911620754 1:100064533-100064555 TTGGGGTCACAGGTGGAGCATGG - Intronic
911904806 1:103553383-103553405 CTGGATCAACAGGTGGGGGAAGG - Exonic
912511051 1:110190379-110190401 GAGGGGAAAGAGGTGGGGGATGG - Intronic
915401261 1:155623633-155623655 TTGGGGAAAAAGCTGAGGCAGGG - Intergenic
915527697 1:156486219-156486241 CTGGGGTCACAGGTGAGGAATGG - Intronic
915839624 1:159203825-159203847 CTGGGGAAACAGCTGAGGAGGGG + Intronic
915944819 1:160141896-160141918 CTGGGCAGACAGGTGGGAGATGG + Exonic
916056690 1:161073194-161073216 GTGGGGACACCGGTGGGGCCGGG + Intronic
916246845 1:162696797-162696819 CTGGGCAGACAGCGGGGGCAGGG - Intronic
917836016 1:178942119-178942141 CGGGGGAAACAGGATGGGGAAGG - Intergenic
917853237 1:179082567-179082589 CAGGGGACGCGGGTGGGGCAAGG - Intronic
918489055 1:185060826-185060848 TTGAGGAAACAGGCTGGGCAAGG + Intronic
919920056 1:202162133-202162155 CTGGGGACACAGGAGGGGGCAGG + Intergenic
919940483 1:202282650-202282672 CTGGGAAATCAGGTGGGGAGGGG + Intronic
920224118 1:204425586-204425608 GTGGGGAAAATGGTGGGGTAGGG - Intronic
920284928 1:204872480-204872502 CTGGTGAGACAGCTGGGGCTGGG + Intronic
920297390 1:204967337-204967359 CTGGGGGAAGAGGTGAGGCTCGG + Intronic
920690976 1:208146065-208146087 AAGGAGAAAAAGGTGGGGCAGGG + Intronic
921316894 1:213900522-213900544 TTGGGGGAACAGGTGGTGCTTGG + Intergenic
921317454 1:213905580-213905602 CTGGGGAAACGGGAGGGGCCGGG + Intergenic
921338739 1:214113170-214113192 TTGGGGAAAAAGGTGGGACGGGG - Intergenic
922414014 1:225403856-225403878 CTGGGGGAACTGGGGGAGCAGGG - Intronic
922414032 1:225403901-225403923 CTGGGGGAACTGGGGGAGCAGGG - Intronic
922724313 1:227915349-227915371 CTGTGTAGCCAGGTGGGGCAGGG + Intergenic
922985243 1:229861261-229861283 CTGGGGAAGCAGGTGTGGAGGGG - Intergenic
923261504 1:232272335-232272357 CAGGCCAAGCAGGTGGGGCAGGG - Intergenic
923339724 1:232997093-232997115 TAGGGGAAAAAGGCGGGGCAGGG - Intronic
923537003 1:234860607-234860629 CTGGGGAAAAATGTGAGGCATGG - Intergenic
924719767 1:246611182-246611204 CTGGGGAAAGGGGTGAGGTAAGG + Intronic
1063448184 10:6133479-6133501 GTGAGGAAACAGGTGGAGGAAGG + Intergenic
1063746974 10:8895080-8895102 CTGGGGAAAATGGTGGGGCGTGG - Intergenic
1064066334 10:12185224-12185246 CTGGGGGAAGGGGTGGGGCATGG + Intronic
1064215050 10:13393334-13393356 TTGGGGAGACGGGAGGGGCACGG + Intergenic
1064271544 10:13870540-13870562 CTGGGGACACAGGTGACCCAAGG + Intronic
1067450020 10:46376370-46376392 CTGGGGAAGCAGGCAGGGCCAGG + Intronic
1067479292 10:46584867-46584889 CTCGGGAAACAGGAGGGGCAGGG - Intronic
1067587225 10:47483393-47483415 CTGGGGAAGCAGGCAGGGCCAGG - Intronic
1067615447 10:47756934-47756956 CTCGGGAAACAGGAGGGGCAGGG + Intergenic
1067634282 10:47991160-47991182 CTGGGGAAGCAGGCAGGGCCAGG - Intergenic
1067948280 10:50705457-50705479 CTGGGGTAAAAACTGGGGCATGG - Intergenic
1067992237 10:51227789-51227811 CTGGGGCATAAGGTGTGGCAGGG + Intronic
1069005010 10:63307857-63307879 CTGGGAAATCAGGCTGGGCACGG + Intronic
1069511906 10:69048785-69048807 CTGTGGACAGAGGAGGGGCAGGG - Intergenic
1069548975 10:69349311-69349333 CTGGTGAGGCAGGTGGGGCAGGG - Intronic
1069623667 10:69853276-69853298 CTGGGGTGCCAGGTGGGGGATGG - Intronic
1070311359 10:75276122-75276144 GTGGGGACGCAGGAGGGGCAGGG + Intergenic
1071650154 10:87386762-87386784 CTGGGGTAAAAACTGGGGCATGG - Intergenic
1072319356 10:94233607-94233629 CTGGGGAAGTAGGTGGGGATAGG + Intronic
1072538835 10:96383130-96383152 CTGGCAGAACAGGTGGGCCAAGG + Intronic
1073136439 10:101223038-101223060 CTGGGGGAACAGATGGGCAAAGG + Intergenic
1073293291 10:102423901-102423923 CAGGGGAAACAGATGGGGATAGG + Intronic
1073319192 10:102603986-102604008 CTGGGGAAACAGCTGGGCTGTGG + Intronic
1073325512 10:102642515-102642537 GTGGGGAAACGGGAGGGCCAGGG - Intergenic
1073327421 10:102650777-102650799 CTGGGGAGGCAGGTGGGGGTTGG + Intronic
1073426801 10:103459847-103459869 CTGGGGAAAGGGGTGGGGTCTGG + Intergenic
1073510128 10:104037711-104037733 CTGGGGGACCAGGTGGGCCTGGG + Exonic
1073779099 10:106817412-106817434 GTGGGGAAGCAGGAGGGGCCTGG - Intronic
1074103780 10:110374230-110374252 CTGGGCATACAGGTGGGCCTGGG + Intergenic
1074608985 10:115003209-115003231 CTGAGAAAACAGGCTGGGCACGG - Intergenic
1075086097 10:119415386-119415408 AAGGGGAAGCAGGTCGGGCAGGG + Intronic
1075090635 10:119442318-119442340 CTTTGGACACAGGTGGGGCTGGG - Intronic
1075639319 10:124053378-124053400 AGGGGGAGACAGGTGGAGCAGGG + Intronic
1075667671 10:124242674-124242696 CAGGGGAAACAGAGGGGGAAGGG + Intergenic
1076414229 10:130273789-130273811 TTGGGGAAAGAGCTGGGCCAGGG - Intergenic
1076841620 10:133048796-133048818 CTGGGAAAGCAGCTGGGGAAGGG - Intergenic
1077017828 11:404715-404737 CTGGGCCACCAGGAGGGGCAGGG + Exonic
1077080759 11:723767-723789 CTTTGGAAACAGGTGGGGCTGGG - Intronic
1077159139 11:1104723-1104745 CTGGGCAAACAGGCTGCGCAGGG - Intergenic
1077320389 11:1938371-1938393 GTGGGGGACCAGGAGGGGCATGG + Intronic
1077401061 11:2357651-2357673 CAGGGGAGACAGGTGGGTCCTGG + Intergenic
1077538073 11:3133959-3133981 CTGGGGAAGAAGGCGGGGCTTGG + Intronic
1077881962 11:6357952-6357974 CTGAGGAAAGAGGTGGGGATAGG + Intergenic
1078097727 11:8310952-8310974 CTGGGGGCCCAGGAGGGGCAGGG - Intergenic
1079081393 11:17415723-17415745 CTGCACAAACAGCTGGGGCAAGG + Intronic
1079239848 11:18714625-18714647 CTGGGGAGAAAGGTGGGCAAGGG + Intronic
1079281315 11:19089637-19089659 CTGGGGAAACAGGTCAGACAAGG - Intergenic
1079370243 11:19846338-19846360 CTGGGGTGAAAGGAGGGGCATGG + Intronic
1079709669 11:23666053-23666075 CTTGGGAAGTAGATGGGGCAGGG + Intergenic
1080365038 11:31564520-31564542 CTGGGGTAGCAGGAGGGGAAGGG - Intronic
1080540302 11:33258029-33258051 CTGGGGATGCGGATGGGGCACGG - Intronic
1081026297 11:38019277-38019299 CTGGGGCACCAGGAGAGGCAAGG - Intergenic
1081507606 11:43734542-43734564 CTGGGGCAGCTGGAGGGGCACGG - Intronic
1081527150 11:43934994-43935016 CTGGGGAAGCAGATGGGGTGGGG - Intronic
1081625830 11:44654546-44654568 TTGGGCAACCAGGTGGGGAATGG - Intergenic
1081646080 11:44791622-44791644 CTGGGGACACAGGGGGGACCAGG - Intronic
1081775592 11:45674225-45674247 CTGGGGTCCCAGCTGGGGCAGGG - Intergenic
1082755647 11:57073589-57073611 CTTGGGAAACAGGTGGCCAAGGG - Intergenic
1083185721 11:61016794-61016816 CTGGGTTAGCAGGCGGGGCAGGG - Intronic
1083261743 11:61526881-61526903 CTGGGAAGGCAGGTGGGGAAAGG + Intronic
1083399128 11:62411809-62411831 CTGGGGAAGCAGGAGTGGGAAGG - Intronic
1083663001 11:64260477-64260499 CTGGGCAGGGAGGTGGGGCAGGG + Intronic
1083813370 11:65117813-65117835 CTAGGGAAAGGGGTGGGGCTTGG - Intergenic
1083996205 11:66274128-66274150 ATGGGGATGCAGCTGGGGCATGG - Intronic
1084008743 11:66336280-66336302 CAGGGCAGCCAGGTGGGGCAGGG - Intronic
1084711374 11:70845979-70846001 CTGGAGAAACAGGTGGCCAAGGG + Intronic
1085303796 11:75473851-75473873 CTGGGGAAACCCTGGGGGCAGGG - Intronic
1085635826 11:78158899-78158921 TTGGAGAAGCAGGTGGGGCCAGG - Intergenic
1086092870 11:83021417-83021439 CTGGGGAATGAGGTGGTGCCTGG - Intronic
1086302260 11:85439647-85439669 CTGAGGAAACAGGCCGGGCGCGG - Intronic
1086844891 11:91736555-91736577 TTTGGGAAACAGGTGGTGCTTGG - Intergenic
1087092555 11:94288729-94288751 CTGGAGAAAGAGGTGGAGAATGG + Intergenic
1087159216 11:94932803-94932825 GTGGGGAGGGAGGTGGGGCAAGG + Intergenic
1087723559 11:101693935-101693957 CTGGGGAACCAGGGGGAGCCTGG + Intronic
1088166970 11:106950579-106950601 CTGGTGAAGAAGGTGGGGGAGGG + Intronic
1089385550 11:118065165-118065187 GTGGAGAAGCAGGTGGGGCAGGG - Intergenic
1089386026 11:118068613-118068635 CTGGGGAATGAGCTGGGGCAAGG + Intergenic
1090064483 11:123491456-123491478 CTGGGGGAAGGGGAGGGGCAGGG - Intergenic
1090412002 11:126515705-126515727 CTGGGGACACAGCTGGGGGCTGG + Intronic
1090884154 11:130861588-130861610 CTGGGGAAGCTGGGCGGGCAGGG - Intergenic
1091076999 11:132628659-132628681 CTGGGGACACAGGTGGTGTAAGG - Intronic
1091208369 11:133835841-133835863 CTGGGGGCACAGTTGGGGGATGG - Intergenic
1091375553 12:22660-22682 TTGGGGGAAGAGGTTGGGCAGGG + Intergenic
1093151992 12:15632856-15632878 CTGTGGAAACCGGTGTGGGAAGG + Intronic
1095121670 12:38426180-38426202 TTGGGGAAACAGGTGGTGTTTGG - Intergenic
1096101188 12:48971422-48971444 CTGGGAAAGCAGGGAGGGCAGGG - Intronic
1096242369 12:49966243-49966265 GTGGGGACACTGGTGGGCCAAGG - Intergenic
1096798606 12:54094367-54094389 CTGGGAATTCAGGTGGGGGAGGG - Intergenic
1097755086 12:63399689-63399711 TTGGGGAAAGAGCTGAGGCAGGG - Intergenic
1098462064 12:70742779-70742801 CGGGGGAAACAGTTGGGAGAAGG + Intronic
1100284529 12:93152647-93152669 CTGTGGAGACATGTGGGGCCAGG - Intergenic
1101337188 12:103807214-103807236 CTAGGGACACAGGTAGGGGAGGG - Intronic
1101577716 12:106013550-106013572 CTGGGTAAAAAGGAGGGGCTGGG - Intergenic
1101728636 12:107408464-107408486 CTGGGAAGACAGTAGGGGCAGGG + Intronic
1101873528 12:108583828-108583850 CTGGGGGAAGAGGAGAGGCAGGG + Intergenic
1102008914 12:109606320-109606342 CTGGGGAGTGAGCTGGGGCATGG + Intergenic
1102034281 12:109761954-109761976 CTGGGGAAGCAGTTGGTGCAGGG - Intronic
1102348112 12:112172496-112172518 CTGACGAAACAGGGAGGGCAAGG - Intronic
1102851176 12:116246758-116246780 CTGGGGAGGGAGGTGGGGAAGGG + Intronic
1103040381 12:117690271-117690293 ATGGGGAAAAAGGCCGGGCACGG + Intronic
1103360973 12:120353371-120353393 CTGGGTAACCTGATGGGGCAAGG + Exonic
1103879546 12:124155472-124155494 ATGGGGAAACTGTTGGGGGAAGG - Intronic
1104946091 12:132415477-132415499 CTGGGGAAGCACTTTGGGCAGGG - Intergenic
1105450168 13:20492576-20492598 TGGCAGAAACAGGTGGGGCAGGG - Intronic
1105607665 13:21940133-21940155 TTGGGGATACAGAGGGGGCATGG + Intergenic
1106077684 13:26475384-26475406 CTGGGGAAGCAAGGGGGGGAGGG + Intergenic
1106409019 13:29498188-29498210 GTGGGGGAACAGGTGAGACATGG - Intronic
1106423225 13:29601270-29601292 CAGGAGAAACTGGTGGGGGAGGG + Intergenic
1108151309 13:47537643-47537665 CTGGGGAAACAGGTGGTGTTTGG - Intergenic
1109275423 13:60298734-60298756 CTGGGTAGACAGGTGAGCCAAGG + Intergenic
1109636460 13:65124446-65124468 AAGAGGAAACAGGAGGGGCAAGG - Intergenic
1109644431 13:65235031-65235053 TTGGGGGAACAGGTGGTGCTTGG + Intergenic
1110075285 13:71232641-71232663 TTGGGGGAACAGGTGGTGCTTGG + Intergenic
1111160478 13:84388554-84388576 TTGGGGAAACAGGTGGTGTTTGG + Intergenic
1112104957 13:96230546-96230568 CTGAGGAAACAGGTCAGGGAGGG + Intronic
1113836689 13:113332727-113332749 CTGGAGAAACAGGCGGGTCCAGG + Intronic
1114382992 14:22228190-22228212 CTGGGGTAGGAGGTGGGGAAGGG - Intergenic
1115249332 14:31329608-31329630 CTGTGAAAGTAGGTGGGGCAGGG - Intronic
1115341659 14:32299236-32299258 TTGGGGAAACAGGTGGTGTTTGG + Intergenic
1116064443 14:39964716-39964738 TTTGGGAAACAGGTGGGGTTTGG - Intergenic
1119148114 14:72334365-72334387 CTGGGGAAGCTGGCAGGGCAGGG + Intronic
1119400592 14:74359725-74359747 GTGTGGGACCAGGTGGGGCAAGG + Exonic
1119738701 14:77000126-77000148 CTGGGGAGACCAATGGGGCAGGG - Intergenic
1119850081 14:77860934-77860956 CTGGGGAGGGAGGTGGGACAAGG + Intronic
1120325321 14:83016918-83016940 TTGGGGAAACAGGTGGTGTTTGG - Intergenic
1121109604 14:91303446-91303468 CTGGGGAGAGAGGTGGAGCCTGG - Intronic
1121735286 14:96213977-96213999 CAGGGGAGACCAGTGGGGCAGGG + Intronic
1122005110 14:98697015-98697037 CTGGGGCCACAGGTGGGGGTGGG + Intergenic
1122030499 14:98908267-98908289 CTGCGGAGGCAGGTGGGGCGGGG - Intergenic
1122127294 14:99586237-99586259 CTTGGGAGACAGATGGGGCCTGG - Intronic
1122232909 14:100315985-100316007 CTGGGGCCACAGGTGGGCGAGGG + Intergenic
1122269424 14:100561875-100561897 TTGGGGTTACAGGTGGGGCCAGG - Intronic
1122597477 14:102903418-102903440 CTCGGAACACAGGTGAGGCAGGG + Exonic
1122717624 14:103705196-103705218 CTGGGGACACTGGTGGGGAAGGG - Intronic
1122783703 14:104154423-104154445 CTGCGGCCACAGGTGGGGCCTGG + Intronic
1122931375 14:104934135-104934157 CTGGGGAGACAGGCGGGCGAGGG + Exonic
1124378123 15:29141448-29141470 ATCGGGAACAAGGTGGGGCAGGG + Intronic
1124797401 15:32795230-32795252 CTGGGGGTTCAGGTGAGGCAAGG + Intronic
1125617297 15:41026260-41026282 CTGTGAAAACAGGCTGGGCACGG + Intronic
1125632055 15:41155104-41155126 TGGGGGAGACAGGTGGGGCGTGG - Intergenic
1125790481 15:42361759-42361781 CTGGGGAAAGAGGATGGACATGG - Intronic
1126029663 15:44483775-44483797 GTGGGGATAAAGGTGGGGCCTGG - Intronic
1127090918 15:55466058-55466080 TTGGGGAAACAGGTGGTGTTTGG - Intronic
1127432361 15:58923064-58923086 CATGGAAAACAGGTCGGGCATGG + Intronic
1127604323 15:60570879-60570901 CTGGGGTAACAGGAGTGGCTTGG + Intronic
1127964982 15:63916565-63916587 CTGGGAAAACAGGTGGGTGAAGG - Intronic
1128225144 15:65996221-65996243 CTGGGGAAATCCGTAGGGCAGGG + Intronic
1128352630 15:66901240-66901262 CTGGGGAACCAGAAGAGGCAGGG + Intergenic
1128657257 15:69471510-69471532 ATTGGGAAGCAGGTGAGGCACGG + Intergenic
1128699942 15:69796804-69796826 CTTGGGACAGAGATGGGGCAGGG - Intergenic
1128731974 15:70027295-70027317 CTGGGGACACCGGCTGGGCAGGG - Intergenic
1129149925 15:73682227-73682249 AGGGGGAAACAGCTTGGGCAGGG - Intergenic
1129389580 15:75213897-75213919 CTAGGGTGCCAGGTGGGGCATGG - Intergenic
1129462415 15:75706225-75706247 CTGGGGAGACAGAGGGGGCTGGG - Intronic
1129540164 15:76342134-76342156 ATGGGGACACAGGTGGGGCGTGG - Exonic
1129832452 15:78679612-78679634 CTATGGAAACAGGTGTGGCAGGG + Intronic
1130223681 15:82043090-82043112 CTGGGGAAAGAGGGTGGGGAGGG + Exonic
1131261957 15:90892197-90892219 GTGGGGAATCAGATGGGGCAGGG - Intronic
1131348782 15:91677201-91677223 AGGGGGAAACAGGTGGGGAGTGG - Intergenic
1131682019 15:94733567-94733589 CTGGGCAAAGAGGTGAGGTAGGG - Intergenic
1132508153 16:322861-322883 CTGGGGGAAGAGGTGAGCCATGG + Intronic
1132558545 16:583339-583361 CTGGGTACACAGGGTGGGCATGG - Exonic
1132646917 16:1003420-1003442 CTGTGGCAGCAGGTGGGGCCCGG - Intergenic
1132957044 16:2599799-2599821 ATAGGGAAACAAGTGGAGCAGGG + Exonic
1132969391 16:2678218-2678240 ATAGGGAAACAAGTGGAGCAGGG + Intergenic
1133002993 16:2860465-2860487 CTGGGGAAACAGTGTGGGCAGGG + Intergenic
1133030454 16:3008431-3008453 CTGGGAAAAGAGGTGGGGGAGGG - Intergenic
1133039482 16:3052761-3052783 CTGGCCACACCGGTGGGGCAAGG + Intronic
1133043326 16:3072394-3072416 CTGGCCACACGGGTGGGGCAAGG + Intronic
1133387640 16:5383195-5383217 GTGGGGAAACAGGAGGAGTAGGG + Intergenic
1134383894 16:13753829-13753851 GTGGGGAAAGAGGTTGGTCATGG + Intergenic
1134452555 16:14372504-14372526 CCTGGGATACAGGTGGGGGAGGG - Intergenic
1134489065 16:14682121-14682143 TTGGGGAAACTGGCTGGGCATGG - Intronic
1135322898 16:21508680-21508702 CTGAGCAGACAGGTGGGGCCAGG - Intergenic
1136334382 16:29601865-29601887 CTGAGCAGACAGGTGGGGCCAGG - Intergenic
1137284874 16:47007184-47007206 ATGAGGAAACAGGTGAGGCATGG + Intergenic
1137403688 16:48173913-48173935 CTGGGTCATGAGGTGGGGCATGG - Intronic
1137441860 16:48504769-48504791 CTGCGGAAGCTGGTGGGGCAGGG + Intergenic
1137494234 16:48957331-48957353 TTGGGGAAACAGGTGGTACTTGG - Intergenic
1138096876 16:54218789-54218811 CTGGGGAAATAGCAGGGGCCAGG + Intergenic
1138459719 16:57141063-57141085 AAGGGGAAAAATGTGGGGCAGGG + Intronic
1139488285 16:67271601-67271623 CTGGGGAGGGAGTTGGGGCAGGG - Exonic
1140747142 16:77990747-77990769 GTGGGGAAACATTTGAGGCAAGG - Intergenic
1141629081 16:85277080-85277102 CTGGGGAAGGAGCTGGGGGAGGG + Intergenic
1141882671 16:86870150-86870172 CTGGGAAATCAGGTGGGTCTAGG - Intergenic
1141979667 16:87542101-87542123 CTGGGGACACAGGTTGGGGGTGG + Intergenic
1142035092 16:87857700-87857722 CTGAGCAGACAGGTGGGGCCAGG - Intronic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1142606964 17:1087385-1087407 TTGAGGAAGCTGGTGGGGCAGGG + Intronic
1142641764 17:1288987-1289009 ATGGGGAACCCGGTGGGGGATGG - Intronic
1142641925 17:1289353-1289375 ATGGGGAACCTGGTGGGGGATGG - Intronic
1142676820 17:1518574-1518596 CTGGGGCAACAGGTGGAGGTGGG + Exonic
1143013898 17:3881553-3881575 CTGGGGACACAGGGAGGGAAAGG + Intronic
1143205882 17:5139053-5139075 ATGGGGAAGCCGTTGGGGCATGG - Intronic
1143356999 17:6337753-6337775 ATGGGAAAGCAGGTTGGGCATGG + Intergenic
1143551702 17:7634373-7634395 CTGCGGAACCAGGTGGGTCCTGG - Intergenic
1145056551 17:19707197-19707219 CTGGGGCCTCATGTGGGGCAGGG - Intronic
1146662501 17:34674119-34674141 ATGGGGCAAGAGGTGGGGAAGGG - Intergenic
1146906529 17:36621720-36621742 CCGGGGAAACAGGGGTGTCAGGG + Intergenic
1147445550 17:40473172-40473194 CTGGGGCAATAGGATGGGCATGG + Intergenic
1147661868 17:42121142-42121164 CTGGGGCTGCAGCTGGGGCAGGG + Exonic
1148164308 17:45472348-45472370 ATGGGGAAACTGGAGGGTCAAGG - Intronic
1148236338 17:45971729-45971751 CTGTGGAAACAGCTGGAACACGG - Intronic
1148334842 17:46834308-46834330 CTGGAGAAGCAGGTGGTGCCTGG + Intronic
1148677199 17:49452313-49452335 CAGGGGAAGCAGGAAGGGCAGGG - Intronic
1148765450 17:50036096-50036118 CGGGGGAGACAGGCAGGGCAGGG - Intergenic
1148832122 17:50440490-50440512 CTGGGCAAACAGGTCTGCCATGG - Intronic
1149024487 17:52010614-52010636 CTGGGGGAAAATGTGGGGGATGG + Intronic
1149982468 17:61322227-61322249 CTGAGGAAATAAGTGGGGCCGGG - Intronic
1150395537 17:64819001-64819023 ATGGAGAAACTGGAGGGGCAAGG - Intergenic
1150422378 17:65049692-65049714 CTGGGGAAAGGGAGGGGGCATGG + Intronic
1150650740 17:67008464-67008486 CTGGGCAAAGAGCTGAGGCATGG + Intronic
1151445933 17:74164004-74164026 CTAGAGAAGCAGGTGGGCCAAGG - Intergenic
1151575541 17:74951084-74951106 CAGGGGAAAAAGGTGTGGCCAGG - Exonic
1151784884 17:76270555-76270577 GTGGGGACACAGGAGGGCCAGGG + Exonic
1151920226 17:77149044-77149066 CTGGAGAGACAGATGGGGAATGG - Intronic
1152432629 17:80257792-80257814 GCGGGGAAGCAGGTGGGACACGG + Intergenic
1152447267 17:80353081-80353103 CTGGGGGAGCAGGTGGTGGAAGG + Intronic
1152477150 17:80525899-80525921 CTGTGGGTACAAGTGGGGCAGGG - Intergenic
1152577971 17:81151273-81151295 TGGGGGAGACAGGTGGGGCTGGG - Intronic
1152591792 17:81217183-81217205 GTGGGCACACAGCTGGGGCAAGG + Intronic
1152638187 17:81438780-81438802 CTGAGGAAGCCGGTGGGGCTAGG - Intronic
1152643225 17:81457769-81457791 CTGGGTAATCAGGAGGGGGAGGG + Intronic
1152643250 17:81457830-81457852 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1152643321 17:81458010-81458032 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1152683194 17:81680483-81680505 CTGGGGAACCATGGGAGGCACGG + Intergenic
1152688902 17:81708526-81708548 CTGGGGGAGCGGGAGGGGCAGGG + Intergenic
1152744592 17:82032924-82032946 CTTGGGAAAAAGGTGGGACCTGG - Intronic
1152901067 17:82941461-82941483 CTGGGGCACCAGCTGGGGCCTGG - Exonic
1152935172 17:83132534-83132556 CTGGGGAACCTGGTGGGGCGGGG - Intergenic
1153107721 18:1547234-1547256 CTGGGGAGACAGGTTGGGAAAGG - Intergenic
1153340459 18:3968180-3968202 CAGGAGAAAGAAGTGGGGCAGGG - Intronic
1155272579 18:24155167-24155189 CTGGGGAAAAAGGTTGGGTGGGG - Intronic
1156866386 18:41893327-41893349 TTGGGGAAACAGGTGGTGTTTGG - Intergenic
1157165977 18:45358866-45358888 GTGGGGAAAGAGGCTGGGCATGG - Intronic
1157619553 18:49008484-49008506 CAGGGGACCCAGGTGGGGCAGGG - Intergenic
1157892075 18:51427408-51427430 GAGGGGAAACAGGGAGGGCATGG - Intergenic
1157899667 18:51502300-51502322 CTGTGGGAACAGGCCGGGCATGG - Intergenic
1158985027 18:62805649-62805671 CAGTGGAAAAAGGTCGGGCATGG - Intronic
1159920663 18:74224577-74224599 CTGGGAATACACGTGGGGCATGG - Intergenic
1160910816 19:1473006-1473028 CCGGGGCAACAGATGGGGCCGGG - Exonic
1160913695 19:1487066-1487088 CTGGGAAACCAGGAGGGGCGGGG + Intronic
1161228910 19:3162770-3162792 CTGGGGAAACAGTGTGGGAAGGG - Intronic
1161398240 19:4056069-4056091 CTGGGGAAACAGGCTGGGGGAGG - Intronic
1161574809 19:5049380-5049402 CAGGGGAGACAGCTGGGGCGGGG + Intronic
1161784053 19:6312138-6312160 TGGGGGGAACAGGTGGGTCAGGG - Exonic
1161790704 19:6358114-6358136 CTGGGGCAACCGGCCGGGCAGGG + Intergenic
1161808534 19:6458878-6458900 CTGGGGCTACAGGTGTGGGAAGG + Intronic
1162023314 19:7878869-7878891 TTGGGGAAACAGCTGAGGGAAGG + Intergenic
1162034130 19:7930137-7930159 CTAAGGAAATAGGTCGGGCACGG - Intronic
1162119422 19:8453680-8453702 CTGGGGAAGCAGAAGGTGCAAGG + Intronic
1162557113 19:11394154-11394176 ATGTAGAAAGAGGTGGGGCATGG - Intronic
1163233061 19:16016704-16016726 CTGGGGATGCAGATGGGGCAGGG - Intergenic
1163237796 19:16039422-16039444 CTGGGGATGCAGGCAGGGCAGGG + Intergenic
1163508272 19:17720622-17720644 CAGGGGAAACAGCTGTTGCAAGG + Intronic
1163616668 19:18333163-18333185 CTAGGGAGCCAGGTGGGGGAAGG - Intergenic
1163686895 19:18716868-18716890 TGGGGGAGCCAGGTGGGGCATGG + Intronic
1164463741 19:28470265-28470287 CTGGGGAAATAAGTTGGGGAAGG - Intergenic
1164674118 19:30090587-30090609 CTGGGGAAACCGGTGGGAGAGGG + Intergenic
1164779078 19:30878232-30878254 ACTGAGAAACAGGTGGGGCATGG + Intergenic
1164782168 19:30901546-30901568 GTGGGAAATCAGGTGGGGCCGGG + Intergenic
1164823478 19:31267468-31267490 CTGGGGACACGGGTAGGGGAAGG - Intergenic
1165098901 19:33426740-33426762 CTGAGGAAACAGGAGGAGCTGGG + Intronic
1166053350 19:40274241-40274263 CTGGGGACACAGTGGGGGCTAGG - Intronic
1166384990 19:42375874-42375896 CTGGGGATCCAGGAGGAGCAGGG + Exonic
1166566156 19:43766888-43766910 CTGGGGCCTCAGGTGGGCCAAGG + Exonic
1166741062 19:45115088-45115110 CTGGGGACACAGCAGTGGCAAGG + Intronic
1167019354 19:46861992-46862014 CAGGGGAATGAGCTGGGGCACGG - Intergenic
1167019591 19:46863321-46863343 CTGGGTAAATAGGTGGGGGTTGG + Intergenic
1167173391 19:47848827-47848849 CAGAGGAAACAGCTGGGGGAAGG - Intergenic
1167522152 19:49961318-49961340 CAGGGGACACAGGTGAGTCACGG + Intergenic
1167523229 19:49969407-49969429 CAGGGGACACAGGTGAGTCATGG - Intergenic
1167799073 19:51728646-51728668 CTGGGGAACCAGTGAGGGCAAGG + Intergenic
1167854275 19:52225647-52225669 CTGGGGCAACAGGTGGGCACAGG - Intronic
1167874631 19:52401480-52401502 CTGGGGAAGCAGATCAGGCAGGG - Intronic
1168255157 19:55161023-55161045 CTGGGGGTAGAGGTGGGGCTGGG - Intronic
1168288818 19:55347290-55347312 CTGGGGTAGCTGGTGGGGCTGGG - Exonic
1168296190 19:55378303-55378325 CTGGGGTAACAGGTGGGGGCTGG + Intergenic
1168387022 19:55972454-55972476 TTGGGGAAACAGGTGGTGTCTGG + Intronic
1168595072 19:57668865-57668887 CTGGTGAAACAGAGGGGGCCCGG - Intergenic
925365381 2:3307688-3307710 CTGGGAAAAGAAGTGAGGCAGGG + Intronic
925380109 2:3418915-3418937 CTGGGGAAGCAGGTGAGGATGGG - Intronic
925686271 2:6476789-6476811 CAGGGGAACCAGGTGGGCCTGGG + Intergenic
926602919 2:14865324-14865346 TTGGGGAAGCAGGTGGGGGTGGG + Intergenic
927043051 2:19249152-19249174 ATGGAGAAACAGGTGAGGAAAGG - Intergenic
927173226 2:20387751-20387773 CAGGGGAAACAGGTTTGGAAAGG + Intergenic
927408125 2:22795637-22795659 CTGAGTAGACAGGTGGGGAAGGG - Intergenic
927496110 2:23553092-23553114 CTGGGGAAAGAGGGGAGGCAGGG - Intronic
927695482 2:25236836-25236858 CTGGAGAAGCAGGCGGGACAAGG + Intronic
927842637 2:26455265-26455287 CGGGAGACACGGGTGGGGCAGGG + Intronic
927846841 2:26476501-26476523 GTGGGGAAGGAGGTGGGGGAAGG - Intronic
927846853 2:26476525-26476547 GTGGGGAAGGAGGTGGGGGAAGG - Intronic
927846865 2:26476549-26476571 GTGGGGAAGGAGGTGGGGGAAGG - Intronic
927846889 2:26476597-26476619 GTGGGGAAGGAGGTGGGGGAAGG - Intronic
927846908 2:26476633-26476655 GTGGGGAAGGAGGTGGGGGAAGG - Intronic
927846934 2:26476681-26476703 GTGGGGAAGGAGGTGGGGGAAGG - Intronic
927846953 2:26476717-26476739 GTGGGGAAGGAGGTGGGGGAAGG - Intronic
927916302 2:26938839-26938861 CAGGGGAGTCAGGTGGGGGAGGG - Intronic
927939927 2:27097126-27097148 CTGGGGAAGCAGGAAGGACAGGG + Intronic
928103666 2:28453766-28453788 CTGTGGACAGAGGTGGGCCAGGG + Intergenic
928444857 2:31324680-31324702 GTGGGGAGAATGGTGGGGCAGGG + Intergenic
929363239 2:41120358-41120380 CTGGTGAAACAGGTAGAGCTAGG + Intergenic
929588366 2:43130192-43130214 CAGGGGAAGCCGGTGGGGCTGGG - Intergenic
929635134 2:43511933-43511955 CTGGGGAAAGAGCTAGGTCAAGG + Intronic
930026234 2:47030700-47030722 GAGGGGGAACAGGCGGGGCAGGG - Intronic
931784624 2:65608083-65608105 CTGGTGATGCAGGTGGGGCAGGG - Intergenic
931788031 2:65639252-65639274 CTGGGGCAGCTGGTGGAGCAGGG - Intergenic
932610018 2:73191950-73191972 CAGGGGAAGCAGGAGGGGCAGGG + Intergenic
933372953 2:81440513-81440535 CTGGGGGCACAGGTGGTGAATGG - Intergenic
933627163 2:84614053-84614075 TGGGGGAAACAGGTGGTGTATGG + Intronic
933993367 2:87649582-87649604 CTAGGGAATCAGGCTGGGCATGG + Intergenic
934554749 2:95281394-95281416 CTGGGGAGAGAGGTGGGGGGCGG + Intronic
934563948 2:95328158-95328180 CTGGGGAAGCTGGTGGGGGCTGG - Intronic
934574777 2:95392944-95392966 CTGGGGAAAGGGGTGAGGGATGG + Intergenic
935788580 2:106570796-106570818 CTGAGGGAAAAGGTGGGGCTCGG + Intergenic
935837928 2:107075643-107075665 CTGGTGAGGCAGGTGGTGCAGGG + Intergenic
936018788 2:108979365-108979387 CTGGGGGAAGTGGTGGGGCAGGG - Intronic
936300490 2:111301301-111301323 CTAGGGAATCAGGCTGGGCATGG - Intergenic
936452112 2:112641555-112641577 CTTGGGATCCAGGTGGGGGAAGG - Intergenic
936634912 2:114244916-114244938 CTGGGAAAGCAGCTGGGGCTAGG - Intergenic
937316181 2:120933390-120933412 ATGGGGAGACAAATGGGGCAGGG + Intronic
937633834 2:124133469-124133491 CTGGTCACACAGTTGGGGCAAGG + Intronic
938015856 2:127866680-127866702 CTGGGGGCACAGTTGGAGCAGGG - Intronic
938560851 2:132470734-132470756 CAGGGGAGACAGGGAGGGCACGG + Intronic
938675038 2:133624125-133624147 TTGGGGAAAAGGGTGGGGGATGG + Intergenic
939304745 2:140396809-140396831 TTGGGGAAACAGGTGGTGTTTGG + Intronic
939618350 2:144386516-144386538 AGGGGGTAACAGGAGGGGCAAGG + Intergenic
940028446 2:149234344-149234366 TTGGGGAAACAGGTGTTTCATGG - Intergenic
941637016 2:167945772-167945794 CTGGCGAAAAAGGAGAGGCAGGG - Intergenic
942173259 2:173307789-173307811 TGGGGGAAACTGGTGGGGCAAGG + Intergenic
943388701 2:187234180-187234202 TTGGGGGAAGAGTTGGGGCAAGG - Intergenic
943797652 2:192017209-192017231 CTGGAGAGGCAGGTGGGGCCAGG + Intronic
944102577 2:196044559-196044581 TTGGGGAAACAGGTGGTGTTTGG - Intronic
946172259 2:217902480-217902502 CTGGGGAACCAAGGGGGGCCGGG + Intronic
946300822 2:218823030-218823052 CTGGGAGCACAGGTAGGGCAAGG + Exonic
947513050 2:230776639-230776661 CTGGAGAAACAAGTAGGTCATGG + Intronic
947520537 2:230842665-230842687 GAAGGAAAACAGGTGGGGCAAGG - Intergenic
948170199 2:235895313-235895335 CTGGGGCAAGAGCAGGGGCACGG - Intronic
948223315 2:236290311-236290333 CTGGTGGAACAGGTGAGGGAAGG - Intergenic
948284601 2:236773924-236773946 CTGGGGAACCAGCTGTGGCTGGG + Intergenic
948858649 2:240742473-240742495 CTGTGGGAACAGGTGGGTCATGG - Intronic
1168872968 20:1146633-1146655 GTGGGGGGAGAGGTGGGGCAGGG - Intronic
1169666449 20:8041876-8041898 CTGTGGAAACAGCAGGGACATGG - Intergenic
1170255194 20:14334645-14334667 CTGGGGCAAAAGGTGGGGGGTGG + Intronic
1170280917 20:14647920-14647942 CTGGGGAAAGAGGTGGTGTTGGG - Intronic
1170493055 20:16898038-16898060 CTGGGGTCTCAGGTGGGGCCTGG + Intergenic
1170649306 20:18225337-18225359 CAGGGAACACTGGTGGGGCAGGG + Intergenic
1170984131 20:21242744-21242766 CTGGGGAACAAGGTGTGGCGGGG - Intronic
1171301381 20:24063959-24063981 TTGGGGAAACAGGAAGGGGAGGG - Intergenic
1171770634 20:29319985-29320007 CCGAGGAAGCTGGTGGGGCAAGG - Intergenic
1171797813 20:29579973-29579995 CTGGGAATTCAGGTGGGGGAGGG + Intergenic
1171850434 20:30304188-30304210 CTGGGAATTCAGGTGGGGGAGGG - Intergenic
1172384226 20:34522262-34522284 ATGGGGAAACAGGTTTGGAAAGG - Intronic
1173023260 20:39285316-39285338 CTTGGGAAAGAGTTGGGGCATGG + Intergenic
1173216450 20:41089314-41089336 CTGGGGGAATAGGCTGGGCACGG - Intronic
1173318914 20:41970039-41970061 CTGGGGTCACAGGAAGGGCAGGG - Intergenic
1173493859 20:43504907-43504929 ATGGGGAAACAGAAGGGGAATGG - Intergenic
1173608659 20:44350700-44350722 CTGGGGGGACAGGAGGAGCACGG - Exonic
1173838550 20:46141152-46141174 CTGGGGGAAGAGGTGGGACTTGG + Intergenic
1174038465 20:47682776-47682798 CTGTGGAAACAGGTGTGGTGGGG - Intronic
1175131855 20:56795253-56795275 GAGGGGAAACAGGCTGGGCATGG - Intergenic
1175241167 20:57550446-57550468 CTGGGGAATGAGGTGGGGTACGG + Intergenic
1175744853 20:61449065-61449087 CTGGGGAAGCAGTTGGGGATGGG + Intronic
1175851564 20:62096808-62096830 CGGGGGAAAGAGGAGGGGCCAGG + Intergenic
1175942425 20:62543611-62543633 CTGGGGCATCAGGAGAGGCAAGG + Intergenic
1175987404 20:62770848-62770870 ATGGGGAAACAGGCTGGGAAAGG + Intergenic
1176073909 20:63239925-63239947 TTGGGGAAACAGGGTGGGCCAGG + Intronic
1176090554 20:63316530-63316552 CTGGGGAAGATGGTGGGGGAAGG - Intronic
1178360824 21:31947530-31947552 CTGGGGAGACAGGAGAGGAATGG - Intronic
1178781278 21:35605030-35605052 CTGAGGAAACAGATGGGATAAGG - Intronic
1179719880 21:43309068-43309090 CTGGGGACCGAGGAGGGGCATGG - Intergenic
1179925557 21:44532178-44532200 CTGGGGAAGATGGTGGGACATGG - Intronic
1180649939 22:17369451-17369473 CCGGAGAAACAGATGGGGCTAGG - Exonic
1181116053 22:20633100-20633122 CTGGAGAAACAGGCCAGGCAAGG + Intergenic
1181922219 22:26329175-26329197 CTAAGGAAACAGGCTGGGCACGG + Intronic
1182367851 22:29790737-29790759 CTCAGGGAAGAGGTGGGGCAGGG - Intronic
1182841949 22:33398251-33398273 TTGGGGATAGAGATGGGGCATGG - Intronic
1183086863 22:35491910-35491932 CAGGGGACACATCTGGGGCAGGG - Intergenic
1183344608 22:37300519-37300541 GTTGGGGAAGAGGTGGGGCAGGG - Intronic
1183481338 22:38067181-38067203 CTGGGGAATCAGTGGGGACAGGG - Intronic
1183513869 22:38251778-38251800 GTGGGGAAAGGGGTGGGGAAGGG + Intronic
1183602187 22:38846225-38846247 CTGGGGATAGAGATGGGCCAAGG - Intergenic
1183987395 22:41577081-41577103 CTGGGCCACCAGGTGGAGCATGG + Exonic
1184320505 22:43739054-43739076 CTGGAGGAAGAGGTGAGGCAAGG - Intronic
1184655927 22:45942047-45942069 CCTGGGAATCAGGTGGGGTAGGG - Intronic
1184690340 22:46114556-46114578 CTGGGTCAACAGGAGGGGCGAGG - Intergenic
1184995032 22:48199239-48199261 CTGGGGAAGGGGGTGGGGGAAGG + Intergenic
1185013655 22:48331287-48331309 CTGGGTAGGCAGGTGGGGCAAGG - Intergenic
949980559 3:9499744-9499766 TTGGGGAACAAGGTGTGGCAAGG + Exonic
950108921 3:10406065-10406087 CTGAGAAAGCAGTTGGGGCAGGG - Intronic
950581346 3:13864312-13864334 CTGGGGAAAGAGGTGGGACCAGG - Intronic
951073762 3:18364605-18364627 CTGGGGGAGAAGGTGGGCCAAGG + Intronic
951706847 3:25552243-25552265 GTGGGCAAACAGGCTGGGCAAGG + Intronic
951740385 3:25915463-25915485 CTTGGGAAATAAGTGGGGGATGG - Intergenic
951907587 3:27720384-27720406 CTGGGGAACCCGCTGGGGCCTGG - Intronic
952229652 3:31416582-31416604 CTGGGGTAAGAGGTGAGGCATGG + Intergenic
953413004 3:42700840-42700862 CTGGGGAGACAGGTTGGGTGAGG + Intronic
954796821 3:53165712-53165734 CTGGGGAAAATGGAGGGGCCTGG - Intronic
956507591 3:69959131-69959153 TTGGGGGAACAGGTGGTGCTTGG - Intronic
956842120 3:73150306-73150328 CTAAAGAAACAGGTGGGGCTGGG - Intergenic
957188423 3:76973900-76973922 ATGGGGACACAGGTGGGGATGGG + Intronic
957404427 3:79758746-79758768 CTTAGGAGACAGGTGGGGAAAGG + Intronic
958837475 3:99162724-99162746 ATGGGGAAACAAGTGGTGTAGGG - Intergenic
959585475 3:108021443-108021465 CTGGGAAATAAGGTGGGGCATGG + Intergenic
959934871 3:112018856-112018878 CTGTGGAACCAGGCCGGGCATGG - Intergenic
960328460 3:116326503-116326525 AATGGGAAACAGGTGGGTCAGGG + Intronic
961454631 3:127017929-127017951 CAGGGTCCACAGGTGGGGCATGG - Intronic
961534292 3:127560197-127560219 CTGGGGACACAGGAAGTGCAGGG - Intergenic
961826240 3:129600624-129600646 CTGGAGAAACAGATAGGGCTTGG - Intronic
961831743 3:129626728-129626750 CTGGGGACAGAGCTGGGGCGGGG + Intergenic
962134878 3:132722579-132722601 GCGGGGAAACAGGAGGGGCGGGG + Intergenic
962201323 3:133403321-133403343 GTGGAGAAACAGGAGGGGTAAGG - Intronic
962811636 3:138963370-138963392 CTGTGTAAACAGGAGGCGCATGG - Intergenic
963042842 3:141081991-141082013 TTGGGGATACAGGAGGGACATGG - Intronic
963958854 3:151285649-151285671 TTGGGGGAACAGGTGGTGCTTGG - Intronic
964325485 3:155541529-155541551 ATGGGGAATCAGGTGGTTCATGG + Intronic
965041098 3:163507985-163508007 CTGGAGAAACAGGTGGGTCTGGG + Intergenic
966866573 3:184261622-184261644 CAGGGGAAAGAGGCGGGGCCGGG + Intronic
967308260 3:188080720-188080742 CTGGGGAGAGAGGTAGGACAAGG + Intergenic
967736413 3:192957355-192957377 CTGGGGAATCAGGGGGGTTATGG + Intergenic
969418216 4:7074808-7074830 CAAGGGAGAGAGGTGGGGCAGGG - Intergenic
970423961 4:15929583-15929605 CTGGGAAACCAGGCAGGGCAAGG - Intergenic
970571737 4:17389967-17389989 ATGGGGATCTAGGTGGGGCAAGG + Intergenic
970671255 4:18398981-18399003 CTTGGGAAAGGGGCGGGGCAGGG - Intergenic
970840516 4:20463229-20463251 CTGGGGAAAGAGGTGGGAGGTGG - Intronic
970891023 4:21044598-21044620 CAGGGGAAACGGGCTGGGCATGG - Intronic
973809743 4:54558140-54558162 CTGGCTAAGCAGGTGGGACATGG - Intergenic
975371967 4:73599508-73599530 CTGGGAAAACAGCTGTGGTAAGG + Intronic
975921700 4:79398422-79398444 CTGAGGAAAGAGGTGTGTCAGGG - Intergenic
976184880 4:82433246-82433268 TTGGGGAAAAAGGTGGGGGAGGG - Intronic
976416977 4:84787840-84787862 GTGGAGAAACAGGAAGGGCAAGG + Intronic
976812271 4:89110642-89110664 CCCAGGAAACAGGTGGTGCAAGG + Intronic
976842810 4:89451541-89451563 ATGGGGAAAGAGTAGGGGCAGGG + Intergenic
978482542 4:109210741-109210763 CAGGGGAAACAGCTGGAACATGG - Intronic
979398989 4:120224497-120224519 CTGGACAAACAGATGGGGCGGGG - Intergenic
980669162 4:135981397-135981419 GTTTGGAACCAGGTGGGGCACGG - Intergenic
982827183 4:160016259-160016281 TTGGGGAAACAACTTGGGCAGGG - Intergenic
983423763 4:167555855-167555877 CTGGAGGTGCAGGTGGGGCAAGG + Intergenic
984769605 4:183425945-183425967 CTGAGGACACAGGAGGGGGAGGG - Intergenic
985240217 4:187923154-187923176 ATTGGGAAACAGGTGGTGCTTGG + Intergenic
985505672 5:278860-278882 CTGGGGACACGGGAGGGGCTGGG + Intronic
985767174 5:1786211-1786233 CTGGGGGGTCAGATGGGGCAGGG - Intergenic
985803450 5:2021423-2021445 CTGGAGAAGCAGGTGGCGGAGGG - Intergenic
986355366 5:6918939-6918961 TTGGGGAAACAGGTGGTGTTTGG - Intergenic
987717866 5:21594858-21594880 CTGGGGACACAGGGGTGCCAAGG + Intergenic
987888381 5:23842073-23842095 TTGGGGACACAGGTGGTGCTTGG + Intergenic
989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG + Intronic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
990742532 5:58926708-58926730 CAGGGGAAAGAGGAAGGGCAGGG + Intergenic
991623811 5:68576014-68576036 AAGTAGAAACAGGTGGGGCATGG - Intergenic
991638816 5:68733324-68733346 CTGGGCAGGCAGGTGGGGCAAGG - Intergenic
991996373 5:72391099-72391121 GTGAGGAAAGAGGTGTGGCATGG + Intergenic
992836857 5:80650213-80650235 TTTGGTAAACAGGTGGGGTAAGG + Intronic
995455600 5:112348569-112348591 ATAGGGAAGCAGGTGGGGGAGGG + Intronic
995527258 5:113059933-113059955 TTGAGGACAGAGGTGGGGCATGG - Intronic
996249995 5:121317602-121317624 GTGGTGGCACAGGTGGGGCAGGG + Intergenic
998427240 5:142039319-142039341 CTGGGGAAACAGCAGTGCCAAGG - Intergenic
998919622 5:147053711-147053733 CTAAGAAAACACGTGGGGCATGG + Intronic
999490590 5:152046585-152046607 CTGAGGAAACAGCCAGGGCAAGG - Intergenic
999522011 5:152360274-152360296 CTGGGGAAGGGAGTGGGGCATGG + Intergenic
999897554 5:156051854-156051876 TGGGGGAAAGAGGTGGGGAAGGG + Intronic
999924349 5:156358896-156358918 GTGGGGAGACAGGTGGGAGAGGG + Intronic
1000072811 5:157756689-157756711 GTGGGGAAAAAGCTGAGGCACGG - Exonic
1001286001 5:170424564-170424586 CTGGGGCTAGGGGTGGGGCAGGG + Intronic
1001648043 5:173296868-173296890 CTAGGGTAGCAGGTGGAGCAGGG + Intergenic
1001695514 5:173667164-173667186 CTGGTGAAATAAGTGGGTCAAGG - Intergenic
1001788319 5:174432901-174432923 TTGGGGAAACAGGTGGTGTTTGG - Intergenic
1001879764 5:175233285-175233307 CTGGGGATTCTGGTGGGGAAAGG - Intergenic
1002100333 5:176854535-176854557 CTGGGGAAGCAGAGGGGTCAGGG - Intronic
1002193156 5:177489325-177489347 GTGGGCAGACAGGTGGGGCTGGG + Intronic
1002471613 5:179439087-179439109 GTGGGGAACCATGTGGGGCCTGG - Intergenic
1002862564 6:1093370-1093392 CTGGGGAGGTAGGTGGAGCAAGG - Intergenic
1002887537 6:1310598-1310620 CTCGGGAGCCAGGTGGGGAATGG - Intergenic
1002902041 6:1417431-1417453 TGAGGGAAACAGGTGGGGCAGGG - Intergenic
1004630898 6:17420171-17420193 CTGGGGATAAAAATGGGGCAGGG - Intronic
1004962762 6:20810241-20810263 CTGGGGCAAGAGAAGGGGCAAGG - Intronic
1004997798 6:21210943-21210965 ATGAGGAAGCAGATGGGGCATGG - Intronic
1006327415 6:33364974-33364996 GTGGGGAAACAGCTGAGGGAAGG + Intergenic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006718100 6:36132730-36132752 CTGGGGAGCAAGGTGGGGGAGGG + Intronic
1006798239 6:36744191-36744213 CTGGGGAAACATCTGGGGTGGGG + Intronic
1007105189 6:39279015-39279037 CTGGGGAAATAGGTGGTGCCAGG - Intergenic
1007223739 6:40298634-40298656 CTGGGGACTCAGGGAGGGCAAGG + Intergenic
1007298240 6:40845164-40845186 TTGGGAAAGCAGGTGGGGGAAGG + Intergenic
1007933423 6:45712635-45712657 CTTGGGGTACAAGTGGGGCATGG - Intergenic
1009324680 6:62336453-62336475 CTGGGGTAAAAGGTGGGCCACGG - Intergenic
1010391436 6:75342780-75342802 CTGTGGAAATAGCTGAGGCAGGG - Intronic
1011203194 6:84861011-84861033 CAGGGGAAAAAGCTGGGTCAAGG + Intergenic
1011985545 6:93439584-93439606 ATGAGGAAACAGTTGGGTCAGGG - Intergenic
1013314160 6:108924937-108924959 GTGGGGAAAGGGGTGGGGCCCGG + Intronic
1014964392 6:127729022-127729044 ATAGGGAAACAAGTGAGGCAAGG - Intronic
1014971987 6:127827998-127828020 TTGGGGAAGCAGGTGAGGAAGGG - Intronic
1015592941 6:134839834-134839856 CTGAGACAACAGCTGGGGCATGG + Intergenic
1015973164 6:138762956-138762978 CTGGGGGGTCAGGAGGGGCAAGG - Intronic
1016211753 6:141544458-141544480 TGGGGAAAACAGGAGGGGCAGGG + Intergenic
1016486299 6:144543295-144543317 CCTGGGAAGCAGGTGGGGGATGG + Intronic
1016727281 6:147387906-147387928 CTGGGGAGACAGCTGAGGAAAGG + Intergenic
1016882516 6:148924606-148924628 CTGGGGATACAATTGGGACAAGG - Intronic
1017454946 6:154593261-154593283 CTGGGGAGAGAGCTGGGGGAGGG - Intergenic
1017842512 6:158232790-158232812 CTGGGGAGACTGGTCCGGCAGGG - Intronic
1018554038 6:165032647-165032669 CTGGGGAAACATCAGGGGCAAGG - Intergenic
1018707047 6:166470751-166470773 TTCGGGAAAGCGGTGGGGCAGGG + Intronic
1019013330 6:168860878-168860900 ATGGGGGAATAGGTGGGGCGGGG + Intergenic
1019736005 7:2650007-2650029 CTGGGGAACCCGCTGGGACACGG - Intronic
1020131173 7:5559300-5559322 ATGAGGAAACTGGTTGGGCACGG + Intronic
1020146162 7:5645103-5645125 ATAGGCAAACAGGCGGGGCACGG - Intronic
1020689775 7:11339755-11339777 TTGGGGATGCTGGTGGGGCAGGG + Intergenic
1021604312 7:22394997-22395019 GAAGGAAAACAGGTGGGGCAAGG - Intergenic
1022953374 7:35359899-35359921 CTGGGGGAACAGGTGGTGCTTGG + Intergenic
1023366109 7:39464957-39464979 TGGGGGAGACAGGTGGGGGAAGG - Intronic
1024208243 7:47182030-47182052 CTTGGGAAGCTGCTGGGGCATGG - Intergenic
1024361748 7:48475752-48475774 ATGAGGAAACAGGTTGGGCGTGG - Intronic
1024633103 7:51265262-51265284 CTGGGAAAGCAGGTGGGGGTTGG + Intronic
1026228364 7:68462663-68462685 CTGGGGAAAGAGGAGGGGAGGGG - Intergenic
1026508295 7:71005626-71005648 CTGGGGAAAGTGGTCAGGCAGGG + Intergenic
1026775632 7:73229544-73229566 CTGGGGCAAGAGGGAGGGCAGGG - Intergenic
1026849117 7:73713979-73714001 CTGGCAAAACAGGTGGAGCCTGG - Intronic
1027016491 7:74782916-74782938 CTGGGGCAAGAGGGAGGGCAGGG - Intronic
1027071538 7:75163020-75163042 CTGGGGCAAGAGGGAGGGCAGGG + Intergenic
1029459598 7:100687287-100687309 CTGGGATGACAGGTGGGGCGGGG - Exonic
1032197466 7:129797625-129797647 CTGGGGAAAAAGCTGGGGGCGGG + Intergenic
1032533327 7:132639621-132639643 CTGGGGAACCAGGTAGGGGTGGG - Intronic
1034263825 7:149772306-149772328 CTGGGGAGACAGAGGGGGAAGGG - Intronic
1034417077 7:150970909-150970931 CTGGGAAGGCAGGTGGGACAGGG - Intronic
1034434285 7:151055724-151055746 CTTGGGAAGAAGGTGGGGAATGG - Intronic
1034913522 7:155017827-155017849 CTGGGGAAACACGTTTGGGAAGG + Intergenic
1035725938 8:1824659-1824681 CAGGGTAAACAGGTGGGGTGCGG - Intronic
1035726171 8:1825299-1825321 GCGGGGGAACAGGTGGGGTACGG - Intronic
1035734250 8:1876311-1876333 CTCGGGGTACAGATGGGGCAGGG + Intronic
1036191855 8:6678183-6678205 ATGGGGAGAGAGGTGGGGGAAGG - Intergenic
1036649780 8:10634887-10634909 TTGGGGAGACTGGAGGGGCAAGG - Intronic
1037017642 8:13928403-13928425 CCGGGGAAAAAGGTGGGAGAAGG + Intergenic
1037830659 8:22186752-22186774 TTGGGGAAACAGGCCAGGCATGG - Intronic
1037950207 8:23014615-23014637 CTGGGGGATGTGGTGGGGCAGGG + Intronic
1038401246 8:27286537-27286559 GTGGGGAAACAGGCCTGGCAAGG + Exonic
1038783713 8:30591348-30591370 CTAGGGCAACAGGTGTGCCACGG - Intronic
1038969652 8:32618920-32618942 CTAGGGAAACTGGCTGGGCATGG + Intronic
1039920180 8:41888220-41888242 CTTGGGAAAGAGGAGGGGGACGG - Intronic
1040504779 8:48037314-48037336 CTAGGGATAGAGGTGGGGGAAGG + Intronic
1040765284 8:50902398-50902420 CTGGGGATACAGGTGCAGTATGG - Intergenic
1041365695 8:57101617-57101639 TTGGGGGAACAGGTGGTGCTTGG + Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1045508221 8:102793756-102793778 CTGTGGAAAGAGATGGGTCAGGG - Intergenic
1047907191 8:129484740-129484762 CTGGGGAAAAGGGAAGGGCAGGG - Intergenic
1048003352 8:130397790-130397812 CTGGGGCCACAGGAGGGGCATGG - Intronic
1048444083 8:134480404-134480426 CTGGGGAAACAGTTGTGACCAGG - Intronic
1048725916 8:137383948-137383970 ATGGGGCAATAGTTGGGGCAGGG - Intergenic
1048748171 8:137639144-137639166 CTGGGGAAAGAAATGAGGCAGGG - Intergenic
1049181720 8:141226389-141226411 CAGGGAAAGCACGTGGGGCAGGG - Intronic
1049204577 8:141357804-141357826 CCGGGCAAACAGGTGGAACAGGG + Exonic
1049273442 8:141708090-141708112 CTGGGGAAGCGGGTGAGGGAGGG + Intergenic
1049442893 8:142617267-142617289 TTGGGGATGCAGGTGGGGGAAGG + Intergenic
1049528613 8:143142412-143142434 CTGGGGAAGGAGGAGGGACAGGG - Intergenic
1049583572 8:143423180-143423202 CAGGGGAGACTGGCGGGGCAGGG - Intronic
1051190146 9:14502757-14502779 TTCGGGAAACAGGTGGTGCTTGG + Intergenic
1051278378 9:15418215-15418237 CTTGGGAAACAGCAGGTGCAAGG + Intergenic
1051585523 9:18722897-18722919 ATGTGGAACCAGGTGGGGCAGGG - Intronic
1052667535 9:31514225-31514247 CAGGAAAAACAGGTTGGGCATGG - Intergenic
1052831389 9:33218719-33218741 ATGGGGAAAAAGGGAGGGCAGGG + Intronic
1053095482 9:35323812-35323834 CTGTAGAAACAGGTTAGGCAAGG - Intronic
1053245614 9:36532403-36532425 ATTGGGAAACAGATGTGGCAAGG - Intergenic
1053545779 9:39021401-39021423 CTGGGGAGACGGGCTGGGCACGG - Intergenic
1053788214 9:41667479-41667501 CTGGGAATTCAGGTGGGGGAGGG - Intergenic
1054156925 9:61647289-61647311 CTGGGAATTCAGGTGGGGGAGGG + Intergenic
1054451213 9:65404429-65404451 CAGGGGAAGAAGCTGGGGCAGGG - Intergenic
1054476697 9:65578297-65578319 CTGGGAATTCAGGTGGGGGAGGG + Intergenic
1055245078 9:74230080-74230102 TTGGGGAAACAGGTGGTGTTTGG - Intergenic
1055521762 9:77088537-77088559 CTGGGGAAATAGGTGGGAATGGG - Intergenic
1056276980 9:85002970-85002992 TTGGAGAAACAGTTGGGGGACGG + Intronic
1056574752 9:87847222-87847244 CTGGGGTAAAAACTGGGGCATGG + Intergenic
1057572296 9:96213917-96213939 TTGTGGAAAAAGGCGGGGCAGGG - Intergenic
1057755795 9:97834041-97834063 CTGGGGGAACAGGGTAGGCATGG - Intergenic
1059880678 9:118685615-118685637 CTGAGGAAACAGAGAGGGCATGG + Intergenic
1060106175 9:120874935-120874957 ATAGGGAAACAGGTGTGGCAAGG + Intronic
1060110989 9:120906050-120906072 CTGGGGAAACAGGTGGGGCAGGG - Intronic
1060371047 9:123071857-123071879 CTGGGGAAACACTTGGTGTATGG + Intronic
1060407883 9:123381768-123381790 CTGGCCAAAGAGGTTGGGCATGG + Exonic
1061749918 9:132770445-132770467 CTGGGGTAGGGGGTGGGGCAGGG + Intronic
1061846329 9:133390550-133390572 CTGCAGAACCAGGTGGGGCAGGG + Intronic
1062035891 9:134382372-134382394 CTGGGGAGACAGTGGGGGCCAGG + Intronic
1062144177 9:134979665-134979687 CTGTGGAAACAGGAAGGGCCTGG + Intergenic
1062342097 9:136098298-136098320 GTGGGGAAGGATGTGGGGCATGG - Intergenic
1062590956 9:137274463-137274485 CTGGGGACCCAGGTGAGGCTGGG + Intergenic
1185486028 X:482196-482218 CTGGGGAACCTGGCCGGGCATGG - Intergenic
1185823746 X:3229022-3229044 ATGGGGAAACAGGGGGAGTAAGG + Intergenic
1186524741 X:10238212-10238234 CTGGGGGTACAGCTGGGGAAAGG + Intergenic
1186587335 X:10889301-10889323 TTGGGGAAACAGGTGGTGTTAGG + Intergenic
1188021933 X:25168651-25168673 CTGGGAGTCCAGGTGGGGCATGG + Intergenic
1188417722 X:29956408-29956430 GTGGGGAATGAGGTGGGACAAGG - Exonic
1189729894 X:44008788-44008810 TTGGGGAAACAGGTGGTGTTTGG - Intergenic
1189848598 X:45158008-45158030 CTGGGGGGCCAGGTGGGGCGTGG + Intronic
1190320124 X:49175156-49175178 GAGTGGAAACAGCTGGGGCAAGG + Exonic
1190336225 X:49264050-49264072 CTGGGAAGGCAGGTGGGGGAAGG + Intronic
1190369951 X:49730975-49730997 CTAGAGATACAGCTGGGGCAGGG + Intergenic
1191629171 X:63302603-63302625 TTGGGGAAACAGGTGGTGTTTGG + Intergenic
1193313827 X:80041255-80041277 TTGGGGAAACAGGTGGTGTTTGG + Intergenic
1193636854 X:83961571-83961593 TTGGGGAAACAGGTGGTGTTTGG - Intergenic
1193695109 X:84699098-84699120 TTGGGGAAACAGGTGGTGTTTGG + Intergenic
1194028236 X:88780942-88780964 TTGGGGAAACAGGTGGTGTTTGG - Intergenic
1194032572 X:88834721-88834743 TTGGGGAAACAGGTGGTGTTTGG - Intergenic
1194094819 X:89626355-89626377 TTGGGGTAACAGGTGGTGCTTGG + Intergenic
1194769707 X:97886720-97886742 CTGGGGAAACAAATGGGGTGAGG - Intergenic
1199120606 X:144048663-144048685 TTGGGGAAACAGGTGGTGCTTGG - Intergenic
1199182395 X:144873557-144873579 CTGAGGGAGCAGGTGGGTCATGG + Intergenic
1199606673 X:149584305-149584327 CTGGGGTGACAGTAGGGGCAGGG + Intronic
1199632450 X:149785063-149785085 CTGGGGTGACAGTAGGGGCAGGG - Intronic
1199947806 X:152681844-152681866 CTGCGGAAACAGCAGGGGCAAGG - Intergenic
1199961873 X:152786610-152786632 CTGCGGAAACAGCAGGGGCAAGG + Intergenic
1200018259 X:153181425-153181447 CTGGGGTGACAGCAGGGGCAGGG - Intronic
1200144004 X:153916563-153916585 CTGGGGAAACTGGCCGGGCCAGG + Intronic