ID: 1060113120

View in Genome Browser
Species Human (GRCh38)
Location 9:120920676-120920698
Sequence ATGTAAGAAGCAGATATTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 339}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060113120_1060113127 14 Left 1060113120 9:120920676-120920698 CCTCTAATATCTGCTTCTTACAT 0: 1
1: 0
2: 0
3: 34
4: 339
Right 1060113127 9:120920713-120920735 ATGGCTCTGGGCACTTCTTTGGG No data
1060113120_1060113123 1 Left 1060113120 9:120920676-120920698 CCTCTAATATCTGCTTCTTACAT 0: 1
1: 0
2: 0
3: 34
4: 339
Right 1060113123 9:120920700-120920722 AGGTAATCAGTCCATGGCTCTGG No data
1060113120_1060113126 13 Left 1060113120 9:120920676-120920698 CCTCTAATATCTGCTTCTTACAT 0: 1
1: 0
2: 0
3: 34
4: 339
Right 1060113126 9:120920712-120920734 CATGGCTCTGGGCACTTCTTTGG No data
1060113120_1060113122 -5 Left 1060113120 9:120920676-120920698 CCTCTAATATCTGCTTCTTACAT 0: 1
1: 0
2: 0
3: 34
4: 339
Right 1060113122 9:120920694-120920716 TACATTAGGTAATCAGTCCATGG No data
1060113120_1060113124 2 Left 1060113120 9:120920676-120920698 CCTCTAATATCTGCTTCTTACAT 0: 1
1: 0
2: 0
3: 34
4: 339
Right 1060113124 9:120920701-120920723 GGTAATCAGTCCATGGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060113120 Original CRISPR ATGTAAGAAGCAGATATTAG AGG (reversed) Intronic
900822963 1:4903508-4903530 ATGTTAGAAGCAATTATTTGTGG - Intergenic
901420576 1:9148110-9148132 GTGTAAGATGCAAATGTTAGAGG - Intergenic
902957015 1:19932340-19932362 ATGTAAAAAGCAGATGTTCAGGG + Intergenic
904484167 1:30814009-30814031 ATGAAAGAAGCAGACATTTGGGG - Intergenic
905276371 1:36821318-36821340 ATGGAGAAAGCAGAGATTAGAGG + Intronic
905628711 1:39506541-39506563 ATGTAAGAAGCTGTCATTAGGGG + Intronic
907205883 1:52770750-52770772 AGGTAAGAACTAGATGTTAGTGG + Intronic
907283410 1:53365422-53365444 AGGTAAGATGCTAATATTAGGGG + Intergenic
907976914 1:59440160-59440182 ATTTAAAAACCAGATATGAGGGG - Intronic
908914816 1:69114262-69114284 TTGTAAAAAGCACATATTACTGG - Intergenic
909783782 1:79584258-79584280 ATATAGAAAGCAAATATTAGAGG - Intergenic
910145481 1:84076006-84076028 ATATAAGAAGCAGAAAAAAGTGG + Intergenic
911698448 1:100922465-100922487 ATGTAAGATGCAGATGTCAAAGG - Intronic
915372674 1:155364547-155364569 ATGTTAGATACAGTTATTAGGGG - Intronic
915409845 1:155692009-155692031 ATCTAAGAAGCAGATGTTCAGGG + Intronic
915410649 1:155699158-155699180 ATCTAAGAAGCAGATGTTCAGGG + Intronic
915779811 1:158534939-158534961 ATCTAAGAAGCAGATGTTTAGGG - Intergenic
918885705 1:190190943-190190965 ATGCAAATAGCAGATATTATAGG + Intronic
919017816 1:192063149-192063171 AGATAAGAAGCAGATATTCAAGG - Intergenic
920329491 1:205195728-205195750 TTTTAAGAAGCAGATAGTATTGG + Intronic
920790790 1:209088457-209088479 TTGGAAGAAGGAGATAGTAGAGG + Intergenic
921228535 1:213045295-213045317 ATTTAAGAAGCAGATTTTTAGGG + Intergenic
921574173 1:216815049-216815071 AGGGAAGAAGCATAGATTAGCGG + Intronic
922248603 1:223825589-223825611 ATGTAAGCTGAAGATATGAGTGG - Intronic
923001816 1:230012385-230012407 AAGTAAGAAACAGATTTTACAGG - Intergenic
923951233 1:238956883-238956905 ATGTAAGATGTCAATATTAGAGG - Intergenic
924063699 1:240202903-240202925 ATGTAAGAAGTAGATTCTGGAGG - Intronic
1063721578 10:8587467-8587489 AAGTAACATGCAGATAATAGTGG + Intergenic
1064336028 10:14442219-14442241 ATGGCAAAAGCAGAGATTAGAGG + Intronic
1064648006 10:17479801-17479823 ATTTGAGAAGCAGATAATAAAGG - Intergenic
1065325588 10:24548373-24548395 ATGTAAAAAGCAAATATTTTTGG + Intergenic
1065578219 10:27145199-27145221 ATGTAAGATGCCAAAATTAGTGG + Intronic
1065619744 10:27568939-27568961 ATGACAGAAGCAGAGATTAGAGG - Intergenic
1066654453 10:37685514-37685536 ATCTAAGAAGCAGATGTTCAGGG - Intergenic
1067840169 10:49669370-49669392 ATGTAAGAAACAGAGACTAAGGG - Intergenic
1067917190 10:50412870-50412892 AAGTGAGAAGCACTTATTAGAGG - Intronic
1068295475 10:55066197-55066219 GTGAAAGAAACAGATATTAAGGG - Intronic
1068542802 10:58314200-58314222 AAGTTAGGAGAAGATATTAGGGG - Intergenic
1068875708 10:61994279-61994301 ATGTTAGAAGTAGATTATAGTGG + Intronic
1069099662 10:64304172-64304194 ATGTAAGTAGAAGCTACTAGGGG - Intergenic
1072027363 10:91474809-91474831 ATGTAATAAGAAGTGATTAGTGG + Intronic
1072539260 10:96385788-96385810 GTGGAAGAGGCAGATATTGGGGG - Intronic
1073665881 10:105533326-105533348 ATGTAAGATGCTAATAATAGAGG + Intergenic
1076012620 10:127002764-127002786 ATGTGATCAGCAGATATCAGGGG - Intronic
1076559705 10:131353412-131353434 ATGTAAGAACCAGGTAATGGTGG + Intergenic
1078938576 11:15975152-15975174 CTGAAGGAAGCAGATAATAGAGG + Intronic
1079527484 11:21407965-21407987 ATATAAGAAGCATATTATAGGGG - Intronic
1080779444 11:35417951-35417973 ATGTGAAAAGCAAATATCAGGGG - Intronic
1080824265 11:35834650-35834672 ATCTAAGAAGAAGATTGTAGTGG - Intergenic
1081151417 11:39637517-39637539 ATAGGAGAAGCAGATTTTAGCGG + Intergenic
1082631753 11:55551002-55551024 GTGTAAGAAGAAAATATTAAGGG - Intergenic
1083491567 11:63018074-63018096 ATGTATAAAGCAGACAATAGAGG + Intergenic
1085325924 11:75606566-75606588 ATGTAAGATGCAGATGTTCTGGG + Intronic
1086289893 11:85296016-85296038 ATGTAAAAAGCAAATCTGAGAGG - Intronic
1086464072 11:87036032-87036054 ATGGAAAAAACAGATATTAGAGG - Intergenic
1088189199 11:107208325-107208347 AAGAAAGAAGCAGAGATTTGAGG + Intergenic
1088196874 11:107284085-107284107 AGGTAAAAAGCAGATAAGAGTGG - Intergenic
1089636464 11:119816747-119816769 ATGTAAAAAGCTGATAACAGCGG - Intergenic
1090449809 11:126796505-126796527 ATGTCAGCAGCAGATACTGGAGG - Intronic
1090651974 11:128815019-128815041 TTGTAATGAACAGATATTAGAGG - Intergenic
1092871588 12:12810470-12810492 ATCTAAGAAGCAGATGTTTAGGG + Intronic
1095585186 12:43841966-43841988 ATTTAAGAAGCTGTTATTACAGG - Intronic
1095613196 12:44156654-44156676 ATGTCAAAATCAGATATTATGGG + Intronic
1095930421 12:47620003-47620025 ATGTAAAATAAAGATATTAGAGG - Intergenic
1097397257 12:59090812-59090834 ATGTAAGAAGTTAATAATAGAGG + Intergenic
1098773700 12:74586743-74586765 ATGCATGAAGCAGCTATTTGAGG - Intergenic
1098804433 12:75004621-75004643 ATGTAGGAAACAGATATGGGGGG - Intergenic
1099702416 12:86103814-86103836 ATGTAAGAATCTTATATTAGAGG - Intronic
1101735723 12:107461393-107461415 ATGACAGAGGCAGAGATTAGAGG + Intronic
1105766471 13:23565044-23565066 ATGCAAGATGCAAATACTAGGGG + Intergenic
1106079187 13:26486544-26486566 ATGTGAGAAGGAGATATAAAAGG - Intergenic
1106973897 13:35182077-35182099 ATGTAAGTAGTAGATAATAATGG + Intronic
1107148978 13:37090575-37090597 ATCTAAGAAGCAGACATTCAGGG - Intergenic
1108739337 13:53319283-53319305 ATGCAAGGATGAGATATTAGAGG + Intergenic
1108741152 13:53339647-53339669 TTTTAAGAAGCAGACATTTGGGG - Intergenic
1109530890 13:63645095-63645117 ATGTAAAAAGCAGATAGAAGTGG - Intergenic
1109612754 13:64788160-64788182 ATATTAAAAGCAAATATTAGTGG + Intergenic
1110128137 13:71974246-71974268 ATGAACCAAGCAGATCTTAGTGG + Intergenic
1112053397 13:95667511-95667533 ATGTATAAAGCAAATATTATTGG - Intergenic
1112116028 13:96355045-96355067 TTGTATGAAGCAGATATAAATGG + Intronic
1112193402 13:97200215-97200237 GTGTAAGGAGCAGATCTTTGGGG + Intergenic
1112768366 13:102771096-102771118 AAGTAAGAAGCAGATAATATTGG - Intronic
1113040798 13:106102022-106102044 TTGTCAGAAGCAGATCTTTGGGG + Intergenic
1114259687 14:21027196-21027218 ATGGAAGAACCATATCTTAGGGG - Intronic
1115050862 14:29061004-29061026 ATGTAAGAATCATATATAAGGGG + Intergenic
1115101848 14:29710729-29710751 ATGTAAGATGATAATATTAGGGG + Intronic
1115366370 14:32562071-32562093 GCGTATGAAGCAGATATTACAGG - Intronic
1115590655 14:34861479-34861501 ATGAAAGAAGGAGAACTTAGTGG + Intronic
1115671409 14:35616592-35616614 ATGTAAGATGTAAATAATAGGGG + Intronic
1115692367 14:35858163-35858185 CTGAAAGAAGCAAATATGAGGGG - Intronic
1115940917 14:38608808-38608830 ATGTGAGGAGCAGATACTTGAGG + Intergenic
1116277490 14:42854457-42854479 TTGTAAGAAGCAGAAATTACTGG + Intergenic
1117129240 14:52668000-52668022 ATATTAGAAGCATAAATTAGGGG + Intronic
1118341828 14:64900502-64900524 AAGTAAGAAGCAGATAGTGGAGG - Intergenic
1118504329 14:66393810-66393832 ATGTAAGAAACAGATCTCTGTGG - Intergenic
1118667874 14:68089819-68089841 ATGTAGGCAGCAGATATTTGTGG + Intronic
1118847110 14:69555712-69555734 ATGTAAGCAGAGGGTATTAGTGG - Intergenic
1119013965 14:71030249-71030271 ATGTAAGAAGCAGAAATGAAAGG - Intronic
1119707280 14:76790989-76791011 AGGTAACAAGCAGATAGTGGGGG - Intronic
1120088632 14:80305545-80305567 AGGCAAGAATCAGATCTTAGAGG + Intronic
1120318442 14:82928043-82928065 ATGTCAGAAACAGCTATTAGAGG + Intergenic
1123687009 15:22805804-22805826 ATGTTAGAAGCACACATAAGTGG + Intronic
1123834993 15:24180551-24180573 ATGTAATAAACACAAATTAGAGG + Intergenic
1123863742 15:24495733-24495755 ATATAACAAGCACAAATTAGAGG + Intergenic
1124389730 15:29243277-29243299 TTGTAAAAAGTAGAAATTAGGGG + Intronic
1124516751 15:30373010-30373032 ATGCAGGAGGCAGATATCAGTGG - Exonic
1124726165 15:32157721-32157743 ATGCAGGAGGCAGATATCAGTGG + Exonic
1124909769 15:33907679-33907701 ATGTAAGAATCAGAGAACAGAGG + Intronic
1127565156 15:60180605-60180627 ATATAAGATGCTGATATTAGGGG + Intergenic
1128692696 15:69737328-69737350 ATTTTAGAAGCAGAGATTAGAGG + Intergenic
1129542726 15:76364190-76364212 ATGGAAGAAGCAGATCTGGGAGG - Intronic
1131590487 15:93742806-93742828 ATGGAAGAATTAGATATTAGAGG + Intergenic
1131787523 15:95929010-95929032 ATGTATGATGTAGATATTAGTGG + Intergenic
1134563355 16:15229806-15229828 ATGTAAGATGCTAACATTAGGGG + Intergenic
1134743690 16:16571066-16571088 ATGTAAGATGCTAACATTAGGGG - Intergenic
1134923881 16:18141435-18141457 ATGTAAGATGCTAACATTAGGGG + Intergenic
1135289665 16:21224438-21224460 AAGTAAAAAGCAGAGATGAGGGG - Intergenic
1136346601 16:29679827-29679849 ATCTAAGAAGCAGATGGTACGGG + Intronic
1139221820 16:65190669-65190691 ATGTAAGATGCTAATATTAGAGG - Intergenic
1139606938 16:68025656-68025678 ATGTGACAAGAAGAAATTAGTGG - Intronic
1142840548 17:2625623-2625645 ATTTAAGAACCATTTATTAGAGG + Intronic
1143621417 17:8082645-8082667 ATCTAAGAAGCAGATGTTCAGGG - Intronic
1145197417 17:20907084-20907106 ATGTGAAAAGCAGGTACTAGAGG + Intergenic
1147685785 17:42286276-42286298 ATGAAAGACACAGATATTCGGGG + Intergenic
1148526991 17:48348533-48348555 ATGTAAGAAGTTGACATTGGGGG - Intronic
1150906181 17:69340786-69340808 ATGTAAGAATTAAATATCAGTGG - Intergenic
1151002967 17:70399906-70399928 ATGTGAGAACGAGATTTTAGAGG + Intergenic
1151006684 17:70445924-70445946 ATGTAAGAAGCTCAAATTAGGGG + Intergenic
1151924627 17:77186025-77186047 ATTTAAGAAGCAAATATAATTGG + Intronic
1152169822 17:78737579-78737601 AAGCAGAAAGCAGATATTAGAGG + Intronic
1153255905 18:3171052-3171074 CTATAAAATGCAGATATTAGTGG - Intronic
1153491371 18:5652014-5652036 ATGTATGAGGGAGATCTTAGGGG - Intergenic
1153811351 18:8754805-8754827 ATGTATGAAGTAAGTATTAGTGG + Intronic
1153976114 18:10269791-10269813 ATGTAAGAAGGAATTCTTAGAGG - Intergenic
1155419840 18:25643452-25643474 AATTAAGAAACAGATAATAGTGG - Intergenic
1156411572 18:36833182-36833204 AGGAAAGAGGCAGATAGTAGCGG + Intronic
1156922085 18:42534204-42534226 TTGCAAAAAGCAGATCTTAGAGG + Intergenic
1158390533 18:57041236-57041258 ATGTAAGAGGCAGGAGTTAGAGG + Intergenic
1159070314 18:63615430-63615452 ATATATGAACCAGATATTTGTGG - Intergenic
1162809772 19:13156670-13156692 AGGTAAGAAGCACATATTCTGGG + Intergenic
1162890415 19:13728756-13728778 ATGTAAGACGCTCAGATTAGGGG - Intergenic
1163018135 19:14469347-14469369 GTGTGAGAAGCGGATATTGGCGG + Exonic
1164093920 19:21987815-21987837 ATCTAAGAAGCAGATGTTCAGGG - Intronic
1164291854 19:23876751-23876773 ATCTAAGAAGCAGATGTTCAGGG + Intergenic
1164795279 19:31021766-31021788 CTGTAGGAAACAGATAGTAGAGG - Intergenic
1165049274 19:33131508-33131530 AAATAAGATGCAGTTATTAGGGG - Intergenic
1165258634 19:34595345-34595367 ATCTAAGAAGCAGATGTTCAGGG + Exonic
1165556455 19:36636721-36636743 ATCTAAGAAGCAGATGTTCAGGG + Intergenic
1165839161 19:38777010-38777032 ATAAAAGATGCAGATATTAAAGG + Intergenic
1166424756 19:42667736-42667758 ATCTAAGAAGCAGATGTTCAGGG + Intronic
1166897182 19:46031266-46031288 ATCTGAGAAGCAGATATTCAGGG - Intergenic
1166902381 19:46075170-46075192 ATGTAAGAAGCTAAAAATAGGGG - Intronic
927769391 2:25845953-25845975 ATGCATGAAGCAGCTATTTGAGG + Intronic
929228644 2:39536893-39536915 ATGTAAGATGCTAATATAAGGGG - Intergenic
929354379 2:41001985-41002007 ATGTAATTAGCAGGTAATAGTGG - Intergenic
929577474 2:43061086-43061108 ATGTAAGATGATGATAATAGGGG - Intergenic
931260039 2:60609816-60609838 ATCCAAGAAGCAGATGTTAGAGG - Intergenic
931467980 2:62508341-62508363 ATGCAAGAAGAAGATATGGGTGG + Intronic
932088696 2:68785650-68785672 AGGTAAGAACAAGATATTAAGGG + Intronic
932885426 2:75545206-75545228 ATGTAAGAAACAGATCTTTTTGG + Intronic
933835935 2:86245553-86245575 ATCTAAGAAGCAGATGTTCAGGG - Intronic
933879176 2:86651521-86651543 ATGTAAGAAGTAAATAATATTGG + Intronic
936173431 2:110197123-110197145 CTGTAGGAAGGAGGTATTAGAGG + Intronic
937742497 2:125373059-125373081 ATTTCTGAAGCATATATTAGAGG + Intergenic
938151968 2:128894882-128894904 CTGAAATAAGCAGATGTTAGGGG - Intergenic
939458964 2:142474614-142474636 ATGTAAGATGCTAATATTAATGG - Intergenic
939682066 2:145148996-145149018 ATGAAAGAAGAACATATTTGAGG - Intergenic
940440087 2:153704864-153704886 ATGTAATAAGCAGATCCCAGAGG + Intergenic
940540795 2:155013834-155013856 ATGTAAGATGCTTATATCAGAGG + Intergenic
942187674 2:173439813-173439835 ATGTAAGAAGTTGTTAGTAGAGG - Intergenic
942782579 2:179662761-179662783 AGATAAAAAGCAAATATTAGTGG - Intronic
943072526 2:183157448-183157470 ATGTAGGAAGCAGATGCTTGAGG - Exonic
943160943 2:184250097-184250119 GTTTTAGAAGCAGATTTTAGAGG + Intergenic
943302895 2:186225595-186225617 ATATAAAAAGCAAATATTAATGG + Intergenic
945710672 2:213290476-213290498 AGGTAAGAACCAGATATGAGGGG + Intronic
946711886 2:222515286-222515308 ATGTGAGAAGCAGATGTTTGGGG - Intronic
947135041 2:226968903-226968925 ATGGAAGAAGATGATATTTGAGG + Intronic
947149450 2:227099785-227099807 ATATAAGAAGCAGAGATTATAGG + Intronic
1169805178 20:9551885-9551907 ATGGAAAAAGCAGATAACAGTGG + Intronic
1170025778 20:11888421-11888443 ATGTAAAAAACAGATTTAAGAGG - Intergenic
1170261466 20:14412951-14412973 CTGTAATAAGCAGAAATTAAGGG + Intronic
1172198670 20:33110016-33110038 ATGTAAGATGCTAACATTAGGGG - Intronic
1173355714 20:42287548-42287570 AAGCAGGAAGCAGATACTAGAGG + Intronic
1174542558 20:51301222-51301244 ATATATAAAGCAGATATTAACGG + Intergenic
1176261607 20:64184813-64184835 ACGTAAGAAGCAGATATTGTGGG + Intronic
1176360321 21:5989807-5989829 ATGTAAGATGCTAACATTAGGGG - Intergenic
1177249238 21:18570611-18570633 AAGTAAGAAGGAAAAATTAGAGG - Intergenic
1178700290 21:34827656-34827678 ATGCAGGAAGCAGAGACTAGAGG - Intronic
1179081590 21:38175890-38175912 CTCTAAGAGGCAGATTTTAGAGG + Intronic
1179763197 21:43548743-43548765 ATGTAAGATGCTAACATTAGGGG + Intronic
1179787625 21:43738801-43738823 ATCTGAGAAGCAGATATTCAGGG - Intronic
1181142750 22:20819106-20819128 ATTTAAGAAGCAGATGTTTAGGG + Intronic
1183126845 22:35790631-35790653 ATGTAAGATGCTAACATTAGGGG + Intronic
1183838596 22:40478367-40478389 ATGTAAGATGCTAACATTAGGGG + Intronic
1184702297 22:46183874-46183896 TTGTTAGAAGCAGAAACTAGAGG + Intronic
949572868 3:5310403-5310425 AGGCAAGCAGCAGATAATAGGGG + Intergenic
950611309 3:14128449-14128471 ATCTTAGAGGCAGATCTTAGGGG - Intronic
951410332 3:22356453-22356475 ACGTGAGAAGCAGATAGAAGAGG + Intronic
955058820 3:55479514-55479536 ATGTCAGAAGTATATATTATAGG - Exonic
955419769 3:58724633-58724655 ATCTAAGAAGCAGATGTTCCGGG - Intronic
955546746 3:60039315-60039337 ATGTATGAAACAGATAAAAGTGG - Intronic
956399015 3:68856631-68856653 AGATAAAAAGCAGATATTACAGG + Intronic
957508680 3:81158675-81158697 ATGTATTATGCAAATATTAGTGG + Intergenic
958073543 3:88646840-88646862 ATTTAAGAAGGAGAAATAAGGGG - Intergenic
958564747 3:95795720-95795742 ATGTAAAAAGCAAATATTTCTGG - Intergenic
959012088 3:101089459-101089481 ATTTAAGAAGCAGATGTTTAGGG - Intergenic
960247710 3:115417568-115417590 ATGAAATAAGGAGATATGAGGGG + Intergenic
960883366 3:122368903-122368925 ATATATGAAGCACAGATTAGTGG + Intronic
962499422 3:135974851-135974873 AAATAAAAAGCAGAGATTAGTGG + Intronic
963075619 3:141343764-141343786 ATGTTCGAAGCAGATTTTTGTGG - Intronic
963466749 3:145691411-145691433 ATCTGAGAAGCAGATGTCAGTGG - Intergenic
966016343 3:175142767-175142789 ATGTAAGAATCAAATATTAATGG - Intronic
966062050 3:175769581-175769603 ATGTAGAAAACAGATTTTAGAGG + Intronic
969189792 4:5508151-5508173 ATGTAAGATGCTGGAATTAGGGG + Intergenic
969493297 4:7512127-7512149 ATGGCAGAAACAGATATCAGAGG + Intronic
970345964 4:15152378-15152400 ATGTAAGAGTCAGAGATGAGGGG + Intergenic
972009855 4:34164423-34164445 ATCTAAAAAGTAGATATTACCGG + Intergenic
973142730 4:46788966-46788988 ATGGAACAAGCAGATATTTTAGG - Intronic
973576381 4:52294051-52294073 CTGTAAGAAGCAAATATATGTGG - Intergenic
974141408 4:57892937-57892959 ATTTAAAAAGTAGATATAAGTGG + Intergenic
974880454 4:67750346-67750368 ATGAATGAAACAGATATAAGTGG - Intronic
977208929 4:94195308-94195330 TTGTAAGAAGAGGAGATTAGGGG - Intergenic
977718094 4:100206770-100206792 AGGTAAGAGGCAGTTATTTGGGG + Intergenic
977934549 4:102786280-102786302 ATGTAATATGTTGATATTAGGGG - Intergenic
977988718 4:103416112-103416134 ATCTAAGAAGCAGATGGTACGGG - Intergenic
978495123 4:109350935-109350957 TAATAAGAAGCAGATCTTAGAGG - Intergenic
978874182 4:113619081-113619103 ATGGATGAAGCAGGTTTTAGGGG - Intronic
978998389 4:115184569-115184591 ATGTATGAGGCAGATATTGGTGG + Intergenic
979251979 4:118575211-118575233 AACTTAGAAGCAGAGATTAGAGG - Intergenic
979812595 4:125057181-125057203 ATATAAGAATAAGAGATTAGTGG - Intergenic
981354934 4:143778130-143778152 ATCTAAGAAGCAGATGTTCAGGG - Intergenic
981427527 4:144620874-144620896 ATGTGAGAAGCAAATATGATGGG - Intergenic
983377226 4:166945650-166945672 ATCTAAGCATGAGATATTAGTGG - Intronic
983445917 4:167852039-167852061 ATGTCAGATTCAGATATTACTGG - Intergenic
983459075 4:168004387-168004409 CTGTAGGATGCACATATTAGTGG - Intergenic
983726282 4:170931518-170931540 ATGCATGAAGCAGCTATTTGAGG + Intergenic
984129612 4:175857060-175857082 ATGTAAGATGCTAATAATAGGGG + Intronic
986006693 5:3674143-3674165 ATATATGAAGCAGAAAGTAGAGG - Intergenic
986058855 5:4168797-4168819 ATGTAAGATGCCAATATTTGTGG + Intergenic
986645302 5:9911000-9911022 ATGAAAGAAGCAGAGGTTGGAGG - Intergenic
987193029 5:15498865-15498887 ATTTAGGAAGCACATATTATTGG + Intergenic
987288499 5:16485018-16485040 AGCTAAGAAGCAGATATCTGTGG + Intronic
987530339 5:19110626-19110648 ATATATGAAACAAATATTAGAGG - Intergenic
988239526 5:28591550-28591572 ATGAAAAAAGAAGATCTTAGAGG + Intergenic
988426160 5:31067218-31067240 TTGAAAGCAGCATATATTAGAGG - Intergenic
988712315 5:33790925-33790947 GTGCAAGAACCAGACATTAGGGG - Intronic
988916155 5:35895319-35895341 ACCTAAGAAGCAGTTAATAGAGG + Intergenic
988921246 5:35944949-35944971 ATGTAAGAAGCAGAGAGAAGGGG + Intergenic
989328955 5:40233027-40233049 ATTTAAGAAGCAGATGGAAGTGG + Intergenic
990232090 5:53723971-53723993 ATGAAAGAAGTAGACATTTGTGG - Intergenic
991295205 5:65073147-65073169 ATGGCAGAAGCAGGTATTAAAGG + Intergenic
992586385 5:78244494-78244516 AGGGAAGAAGCAGGTATTTGGGG + Intronic
993849564 5:92989942-92989964 ATATAAGAGGCTAATATTAGGGG + Intergenic
994132748 5:96249153-96249175 ATGAAAGAAGAAAATATTGGTGG + Intergenic
994260103 5:97647967-97647989 ATGTAAGATGTTGATAGTAGGGG - Intergenic
994409757 5:99392144-99392166 ATGTTAGAAGCTAATGTTAGTGG + Intergenic
994442062 5:99820342-99820364 ATTTAATATGCAGCTATTAGTGG + Intergenic
994923616 5:106084809-106084831 ATATAAGAAGGAGATACTTGCGG - Intergenic
995259937 5:110091815-110091837 AGGGAAGGAGTAGATATTAGAGG - Intergenic
995536942 5:113146031-113146053 AAGTAACAAGAATATATTAGAGG + Intronic
996990271 5:129622138-129622160 ATGTAAAAAGCTGATATGATTGG - Intronic
997167898 5:131681252-131681274 ATTGAAGGAGCAGAGATTAGGGG + Intronic
997760064 5:136437450-136437472 ATGTAAGATGTTGATAATAGAGG - Intergenic
998628268 5:143870225-143870247 ATGTAAGATTAAGATTTTAGAGG - Intergenic
999913529 5:156232318-156232340 GTTTTAGAAGCAGATATTGGAGG - Intronic
1000791799 5:165617119-165617141 ATGCATGGAGCAGATATTTGAGG - Intergenic
1000840523 5:166212300-166212322 ATCTAAGAAGGAGATATGTGGGG - Intergenic
1000894717 5:166842065-166842087 ATGTATGATGTATATATTAGAGG - Intergenic
1001307701 5:170587644-170587666 ATGACAGAAGCAGAGATTGGAGG - Intronic
1003557177 6:7150588-7150610 ATTCAAGAAACAGAAATTAGTGG - Intronic
1005245939 6:23885283-23885305 ATGTAAGAAGCAGCTCACAGAGG + Intergenic
1005721651 6:28608252-28608274 ATCTAAGAAGCAGATGTTCAGGG - Intronic
1005804197 6:29458754-29458776 TTTTAAGAAGCAGATATTCCAGG + Intronic
1005968013 6:30741413-30741435 ATGGAAGAAGCATTTCTTAGAGG - Intronic
1006150580 6:31984873-31984895 ATCTAAGAAGCAGATGTTCAGGG + Intronic
1006151134 6:31990686-31990708 ATCTAAGAAGCAGATGTTCAGGG + Intronic
1006156881 6:32017611-32017633 ATCTAAGAAGCAGATGTTCAGGG + Intronic
1006157435 6:32023424-32023446 ATCTAAGAAGCAGATGTTCAGGG + Intronic
1006223221 6:32513183-32513205 ATCTAAGAAGCAGATGTTCAGGG - Intergenic
1007033038 6:38646384-38646406 ATCTAAAAAGCAGATGGTAGAGG - Intergenic
1010185679 6:73140939-73140961 ATAGGAGAAGCAGATCTTAGGGG - Intronic
1010320759 6:74506229-74506251 ATGTAACAAGAAAATATTTGAGG + Intergenic
1010564619 6:77394607-77394629 ATGTAAATGGCAGACATTAGGGG - Intergenic
1010849755 6:80758404-80758426 ATATTTGAAGCAAATATTAGTGG - Intergenic
1011659364 6:89581062-89581084 ATGTAAGAAGCAGGTAAGACAGG - Intronic
1013808442 6:114018165-114018187 ATCTAAGAAGCAGATGTTCAGGG - Intergenic
1014526231 6:122505025-122505047 ATCTAAGAAGCAGATGTTTAGGG + Intronic
1014537330 6:122630023-122630045 ATGTAAGATACAAATAATAGGGG + Intronic
1015064375 6:129006153-129006175 ATGTTAGAAGCAAATATCACAGG + Intronic
1016145658 6:140669504-140669526 ATGATAGAAGCAGAAATTGGAGG - Intergenic
1016186485 6:141203931-141203953 ATGTAAGATGCTAATACTAGAGG + Intergenic
1016222753 6:141695339-141695361 AAAAAAGAAGCAGATTTTAGTGG + Intergenic
1016662191 6:146594674-146594696 ATGTAAGAAGGGGATATAAATGG - Intergenic
1017217007 6:151920405-151920427 ATGTAAGATGTCGATAATAGAGG - Intronic
1017704454 6:157108820-157108842 ATGTAAAAAGCAGCTTCTAGTGG + Intronic
1017743843 6:157429518-157429540 CTGTATGTAGCATATATTAGAGG + Intronic
1018424545 6:163668573-163668595 ATGTATGAAGCTGATATTATAGG + Intergenic
1018646519 6:165953683-165953705 GTGCAAGACGCAGATAGTAGAGG - Intronic
1020660053 7:10971736-10971758 ATATAAGATACTGATATTAGTGG + Intergenic
1021387589 7:20050879-20050901 ATGTGATAAGGAGCTATTAGAGG - Intergenic
1022052701 7:26693665-26693687 ATTTAATAAGCAGATTTTAGAGG + Intronic
1023746766 7:43329393-43329415 CTGTAAGGTGCTGATATTAGAGG + Intronic
1024090421 7:45935193-45935215 ATGCATGGAGCAGATATTTGAGG - Intergenic
1024398410 7:48894878-48894900 ATGTAGGAAGCAGATAAGGGTGG + Intergenic
1024523489 7:50328170-50328192 ATTTAAGAACTAGAGATTAGAGG - Intronic
1024994240 7:55259861-55259883 ATGACAGAAGCAGATATTGATGG - Intergenic
1027626407 7:80550347-80550369 ATGTAAAAAGGGGATAATAGAGG + Intronic
1028511054 7:91626702-91626724 ATGTAAAAAATAGATATTGGAGG + Intergenic
1028614916 7:92755378-92755400 ATGTGACAAGCAGAAATTAATGG + Intronic
1030083184 7:105795085-105795107 GTGTGAGAAGCAGATTTCAGCGG - Intronic
1030373121 7:108723254-108723276 ATTTAAGAAGCAGATAAGAAGGG + Intergenic
1030553012 7:110988348-110988370 AGGAAAGAAACAGATAGTAGAGG + Intronic
1030623870 7:111822083-111822105 ATGTAAGAAACAAATACAAGTGG + Intronic
1030901844 7:115134039-115134061 TTGTAAGCAGCAAATATTAGTGG + Intergenic
1032230482 7:130070016-130070038 ATGTAAGAACCAGATATTCCTGG - Intergenic
1032276818 7:130464669-130464691 ATATATGAAGCAAATATTAATGG - Intergenic
1032411832 7:131700007-131700029 ATGAAAGAAGCATAGATTTGGGG - Intergenic
1033234574 7:139628083-139628105 AAGAAGGAAGCAGAGATTAGAGG + Intronic
1033835100 7:145300626-145300648 ATGTAAGAAGTTAATACTAGGGG - Intergenic
1034027693 7:147724871-147724893 ATGTCAGAAGCAAATATAATTGG + Intronic
1037945193 8:22985269-22985291 ATCTAAGAAGCAGATGTTCAGGG + Intronic
1039559208 8:38499129-38499151 ATGTAAGATGTTGATAATAGAGG - Intergenic
1042006020 8:64181115-64181137 ATATATGAAGCAAATATTAATGG + Intergenic
1042704426 8:71651128-71651150 AACTAAGAACCAGATATTAAGGG + Intergenic
1042776938 8:72442566-72442588 ATGTAAAATGCTGACATTAGGGG - Intergenic
1043250182 8:78062659-78062681 ATGAAAGAAGCCAATATTAAAGG + Intergenic
1043637233 8:82400935-82400957 ATGTTAGAGGCAGATATATGGGG + Intergenic
1044942913 8:97361502-97361524 AAGCAAGAAGCAGAGACTAGGGG - Intergenic
1045039689 8:98211030-98211052 TTGAGAGGAGCAGATATTAGGGG + Intronic
1045206427 8:100045978-100046000 ATGAAAGAAGCAGACATAGGAGG + Intronic
1046610933 8:116424845-116424867 ATGATGGAAGCAGATGTTAGAGG - Intergenic
1047065017 8:121272168-121272190 CTGTAGGAAGCAGATATTGAGGG + Intergenic
1050392706 9:5162738-5162760 ATGTATGACACAGATATAAGTGG + Intronic
1050689819 9:8213888-8213910 GCGTATGAAGCAGATATTACAGG - Intergenic
1051013152 9:12443567-12443589 ATGGAAGAACCATATATTAAAGG + Intergenic
1051773247 9:20603075-20603097 AAGTGAGAAGGAGAAATTAGAGG - Intronic
1053334577 9:37254572-37254594 AAGTAATAAACACATATTAGCGG - Intronic
1054736569 9:68757884-68757906 ATGCATGAAGCAGCTATTTGAGG + Intronic
1055121714 9:72667321-72667343 ATCTAAGGATCAGATTTTAGAGG - Intronic
1056593434 9:87984324-87984346 ATCTAAGAAGCAGATGTTCAGGG + Intergenic
1057116077 9:92523583-92523605 ATCTAAGAAGCAGATGTTTAGGG + Intronic
1058145202 9:101402767-101402789 ATTTAAGAAGCATATAATATAGG - Intronic
1058305165 9:103432078-103432100 ATGTAAGATGTTAATATTAGGGG + Intergenic
1059670773 9:116490174-116490196 ATGAAAGAAACTGATATAAGAGG - Intronic
1059865781 9:118512476-118512498 ATTCAAGAAGCAGATATTGCTGG - Intergenic
1060113120 9:120920676-120920698 ATGTAAGAAGCAGATATTAGAGG - Intronic
1060751415 9:126171979-126172001 ATGTAAGATGCTAATAATAGGGG - Intergenic
1187657592 X:21495363-21495385 TTGTAACAAGTAGATATTAATGG + Intronic
1187738117 X:22325122-22325144 AACTAAGAGGAAGATATTAGTGG - Intergenic
1188518497 X:31012770-31012792 ATGTAAGAGCCAGATAGAAGTGG - Intergenic
1188772996 X:34176997-34177019 AAGTAAAAAGCAGTTAGTAGTGG + Intergenic
1189029473 X:37435924-37435946 ATGTAAGAAGCTCACATTAAGGG + Intronic
1189265498 X:39712869-39712891 ATGAGAGAAGCAGATCTTAGAGG - Intergenic
1189666248 X:43357860-43357882 ATGTGAGAAGCAGAGACTTGAGG + Intergenic
1189971458 X:46421829-46421851 ATGCAGGAAGCAGATACTTGAGG + Intergenic
1190556035 X:51636860-51636882 ATCTAAGAAGCAGATGTTCAGGG - Intergenic
1190904086 X:54708968-54708990 ACATAAGATGAAGATATTAGAGG - Intergenic
1191142607 X:57132626-57132648 ATGTAAGTAACAGATAATGGTGG - Intergenic
1191715475 X:64191071-64191093 ATGCAAGAAGCAAATTTTGGAGG - Exonic
1192680182 X:73244730-73244752 ATATATGAAGCAAATATTAGAGG + Intergenic
1193204602 X:78733605-78733627 ATGTATAAAGCAAATATTATTGG - Intergenic
1193990905 X:88305862-88305884 ATTTAAGAAACAGAAAATAGAGG - Intergenic
1194203220 X:90979613-90979635 TGGTAAGAAGCAGAAAATAGAGG + Intergenic
1194898784 X:99480605-99480627 ATGTAAGATGCTAATGTTAGAGG - Intergenic
1196528512 X:116755992-116756014 ATGTTAAAAGCATATTTTAGAGG - Intergenic
1197537805 X:127711536-127711558 TTGTAGGCAGCAGATATTTGGGG - Intergenic
1197648411 X:129041107-129041129 AGGTAAGAAACAGAAATTAGAGG + Intergenic
1198208195 X:134489227-134489249 ATTTAAAATGCATATATTAGGGG - Intronic
1198603962 X:138315903-138315925 TTGTAAGATGCTGACATTAGAGG - Intergenic
1198623932 X:138547136-138547158 ATCTAAGAAGCAAATTTTATAGG - Intergenic
1198712274 X:139518111-139518133 ATTTAAGAAGCAGATGTTCAGGG - Intergenic
1199740843 X:150734796-150734818 ATGCAAGAAGAAGATATGAAAGG - Intronic
1200549051 Y:4555039-4555061 TGGTAAGAAGCAGAAAATAGAGG + Intergenic
1201346849 Y:12994053-12994075 ATCTAAGAAGCAGATGTTCAGGG + Intergenic