ID: 1060113124

View in Genome Browser
Species Human (GRCh38)
Location 9:120920701-120920723
Sequence GGTAATCAGTCCATGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060113120_1060113124 2 Left 1060113120 9:120920676-120920698 CCTCTAATATCTGCTTCTTACAT 0: 1
1: 0
2: 0
3: 34
4: 339
Right 1060113124 9:120920701-120920723 GGTAATCAGTCCATGGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060113124 Original CRISPR GGTAATCAGTCCATGGCTCT GGG Intronic
No off target data available for this crispr