ID: 1060113189

View in Genome Browser
Species Human (GRCh38)
Location 9:120921039-120921061
Sequence ATGGACTTCTGGTGAAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 139}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060113189_1060113201 11 Left 1060113189 9:120921039-120921061 CCAGCTTTTCACCAGAAGTCCAT 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1060113201 9:120921073-120921095 GTGGGGAAGCCAGCAGGGAGGGG No data
1060113189_1060113199 9 Left 1060113189 9:120921039-120921061 CCAGCTTTTCACCAGAAGTCCAT 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1060113199 9:120921071-120921093 AGGTGGGGAAGCCAGCAGGGAGG No data
1060113189_1060113205 17 Left 1060113189 9:120921039-120921061 CCAGCTTTTCACCAGAAGTCCAT 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1060113205 9:120921079-120921101 AAGCCAGCAGGGAGGGGAGGGGG No data
1060113189_1060113204 16 Left 1060113189 9:120921039-120921061 CCAGCTTTTCACCAGAAGTCCAT 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1060113204 9:120921078-120921100 GAAGCCAGCAGGGAGGGGAGGGG No data
1060113189_1060113197 5 Left 1060113189 9:120921039-120921061 CCAGCTTTTCACCAGAAGTCCAT 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1060113197 9:120921067-120921089 CACGAGGTGGGGAAGCCAGCAGG No data
1060113189_1060113198 6 Left 1060113189 9:120921039-120921061 CCAGCTTTTCACCAGAAGTCCAT 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1060113198 9:120921068-120921090 ACGAGGTGGGGAAGCCAGCAGGG No data
1060113189_1060113194 -6 Left 1060113189 9:120921039-120921061 CCAGCTTTTCACCAGAAGTCCAT 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1060113194 9:120921056-120921078 GTCCATGACTCCACGAGGTGGGG No data
1060113189_1060113192 -8 Left 1060113189 9:120921039-120921061 CCAGCTTTTCACCAGAAGTCCAT 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1060113192 9:120921054-120921076 AAGTCCATGACTCCACGAGGTGG No data
1060113189_1060113202 14 Left 1060113189 9:120921039-120921061 CCAGCTTTTCACCAGAAGTCCAT 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1060113202 9:120921076-120921098 GGGAAGCCAGCAGGGAGGGGAGG No data
1060113189_1060113193 -7 Left 1060113189 9:120921039-120921061 CCAGCTTTTCACCAGAAGTCCAT 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1060113193 9:120921055-120921077 AGTCCATGACTCCACGAGGTGGG No data
1060113189_1060113200 10 Left 1060113189 9:120921039-120921061 CCAGCTTTTCACCAGAAGTCCAT 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1060113200 9:120921072-120921094 GGTGGGGAAGCCAGCAGGGAGGG No data
1060113189_1060113203 15 Left 1060113189 9:120921039-120921061 CCAGCTTTTCACCAGAAGTCCAT 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1060113203 9:120921077-120921099 GGAAGCCAGCAGGGAGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060113189 Original CRISPR ATGGACTTCTGGTGAAAAGC TGG (reversed) Intronic
904323046 1:29709078-29709100 TTGGTCTTCTGGAGAACAGCAGG + Intergenic
905183502 1:36180233-36180255 AAGGACTTCTGGGGAAAAACAGG - Exonic
909119440 1:71582709-71582731 ATACATTTCTGGGGAAAAGCAGG - Intronic
909691936 1:78418773-78418795 ATGGACCTCTGTGTAAAAGCAGG + Intronic
909794295 1:79713728-79713750 ATGGACTTCGGGTGATAATAAGG + Intergenic
910515096 1:88052267-88052289 ATGGACTTGTGGTCAAAATAAGG - Intergenic
912184091 1:107253599-107253621 ATTGCCTTCTGGGGAAGAGCAGG - Intronic
914752619 1:150545827-150545849 AGGGACTCCTGGTGACAACCTGG - Intergenic
915502693 1:156330244-156330266 ATGGACTTTTAGGGAAAACCTGG - Intronic
917535179 1:175869321-175869343 CTGAACTTCTGGGGAGAAGCAGG - Intergenic
918639697 1:186824966-186824988 ATAAACTTCAGGTGAAAAGAGGG + Intergenic
921224628 1:213005987-213006009 ATAGTTTTCTGGAGAAAAGCAGG - Intronic
1063862074 10:10321827-10321849 ATGGATTTCTGATGAGAAGATGG + Intergenic
1064177503 10:13087600-13087622 ATGGAAGTCTGGGGAAAAACAGG + Intronic
1064879593 10:20035827-20035849 ATCAACTTCTGTGGAAAAGCTGG - Intronic
1067415456 10:46098491-46098513 ATCAAGTACTGGTGAAAAGCCGG + Intergenic
1067435494 10:46273566-46273588 ATCAAGTACTGGTGAAAAGCCGG + Intergenic
1067921934 10:50467971-50467993 ATGGACTTCTGGGAATAAGATGG + Intronic
1071230518 10:83580307-83580329 GGGGGCTTCTGGTGAAGAGCAGG + Intergenic
1071667037 10:87568471-87568493 ATGGACTTTTGGGGTAATGCTGG + Intergenic
1071811596 10:89187755-89187777 CTGGACTTCTAATGAAAAGAAGG - Intergenic
1073606135 10:104897521-104897543 ATGTACTTCTCTTTAAAAGCAGG + Intronic
1074669642 10:115775067-115775089 ATGGACATCTCATCAAAAGCAGG - Intronic
1078108590 11:8373895-8373917 TTGGACTGCTGGTGAGAGGCAGG - Intergenic
1079014292 11:16855728-16855750 ATGGACTTCTGGTTACAAAGGGG + Intronic
1081714543 11:45239518-45239540 ATGAACTCCTGGTGGCAAGCAGG - Intergenic
1084614588 11:70227117-70227139 TCAGACTGCTGGTGAAAAGCAGG + Intergenic
1084686594 11:70699728-70699750 ATGTGCTTTTGGTGAACAGCTGG - Intronic
1085835642 11:79953472-79953494 ATGGACTTCAGGAGTAATGCTGG + Intergenic
1089058925 11:115610046-115610068 ATGGTCTTTGGGAGAAAAGCTGG + Intergenic
1093430182 12:19076128-19076150 ATGGATTGCTGGTTAAAAGCAGG - Intergenic
1095569021 12:43660852-43660874 TAGCACTTCTGGTAAAAAGCTGG + Intergenic
1095767597 12:45914186-45914208 ATCCATTTCTGGTGATAAGCAGG - Intergenic
1097626246 12:62003899-62003921 ATGCACTTCTTGTGAAAAATGGG - Intronic
1099842251 12:87980887-87980909 ATGGACTACTGGAGGAAAGGAGG - Intronic
1100460212 12:94792296-94792318 ATTGACTTCTTGTGAAAATAAGG - Intergenic
1105026136 12:132850392-132850414 TTGGATTCCTGGGGAAAAGCTGG + Intronic
1108042937 13:46356278-46356300 ATGGACTCCTCATGAAAAGGAGG + Intronic
1109324892 13:60855305-60855327 ATGGGCCACTGGAGAAAAGCAGG - Intergenic
1114805546 14:25831880-25831902 ATAAACTTCTGATGAAAATCAGG - Intergenic
1115709486 14:36034644-36034666 ATAGACTTTTGGTCAAAAACTGG - Intergenic
1116390313 14:44383604-44383626 AAAGACTACTGGTGAAATGCAGG - Intergenic
1117291448 14:54337801-54337823 ATGGACTTATGGTGAATAAGGGG - Intergenic
1117668228 14:58079396-58079418 GTGGGCTCCTGGTAAAAAGCGGG - Intronic
1119625394 14:76170132-76170154 ACTGCATTCTGGTGAAAAGCAGG - Intronic
1119987163 14:79150882-79150904 TTGGACTTCTGCTGAATTGCTGG - Intronic
1120064673 14:80027165-80027187 AAGGCCTTCTGGAGAAAAGGTGG + Intergenic
1123872948 15:24594801-24594823 AAGGACTTCTGGGGACAGGCTGG - Intergenic
1125504184 15:40257481-40257503 CACCACTTCTGGTGAAAAGCGGG + Intronic
1126073731 15:44888128-44888150 ACGGAGTTTTGGTGAAAAGATGG + Intergenic
1127565371 15:60183079-60183101 ATGGCCTTGTGGTCAACAGCGGG + Intergenic
1127792350 15:62409344-62409366 ACTGGCTTCTGGTAAAAAGCAGG - Intronic
1127881784 15:63164563-63164585 ATGGACTTTTGGGGAAGAGAAGG - Intergenic
1129233502 15:74209627-74209649 ATGTACTTGGGGTGAAGAGCAGG - Intronic
1130016302 15:80189244-80189266 ATGGACCACTGGTTAAAAACAGG - Intergenic
1132014102 15:98300672-98300694 ACAGACTTCTGGGGAGAAGCAGG - Intergenic
1139162483 16:64527858-64527880 GTGGAGTTCTGTGGAAAAGCAGG - Intergenic
1146272846 17:31495693-31495715 ATGGTCTCCTGGTGAAATGAGGG + Intronic
1147544575 17:41390841-41390863 ATACACTTCTGGTGCACAGCTGG + Intronic
1147682529 17:42260281-42260303 ATGCATTTCTGGTGAAAATTTGG + Intronic
1147710899 17:42463782-42463804 TAGGGCTTCTGGTCAAAAGCAGG - Intronic
1151254926 17:72869242-72869264 ATGGACACCTTGTCAAAAGCTGG - Intronic
1157827605 18:50826414-50826436 ATGGAGTTGTGGTGGGAAGCTGG - Intergenic
1158666270 18:59435671-59435693 ATGGACTCTTAGTGAGAAGCAGG + Exonic
1164775843 19:30853003-30853025 GTGGATTTTGGGTGAAAAGCTGG + Intergenic
1166314816 19:41983519-41983541 ATGGACTTCTGGGGTGAAGCTGG + Intronic
925022939 2:586300-586322 TTGGATTTCTGCTGAAAAGGAGG - Intergenic
928235183 2:29533128-29533150 AGCGACTTCTGGTTAAAATCAGG + Intronic
928924655 2:36565495-36565517 AGGGACATCTGGGGAAATGCAGG - Intronic
929266969 2:39929135-39929157 CTGTGCTTCTGGGGAAAAGCGGG - Intergenic
929958936 2:46481309-46481331 GTGTACTTCTTGTGAAAAGATGG - Intronic
930553035 2:52859930-52859952 ATCGACTTGTGGTGATAAGATGG + Intergenic
931324614 2:61206586-61206608 ATGAACTCCTGATGTAAAGCTGG - Intronic
932926572 2:75982158-75982180 ATGGCCTACTGGGGCAAAGCAGG - Intergenic
933632962 2:84677274-84677296 ATGGACTCCTGGAGAGTAGCTGG + Intronic
936770371 2:115905680-115905702 ACTGACTTCTGTTGAAAAGGGGG - Intergenic
937670758 2:124535128-124535150 ATGGCCTTCTGGTGACCACCGGG + Intronic
938465515 2:131522324-131522346 AGGGACTTCTGGGGAAAGACTGG + Intergenic
939872717 2:147542861-147542883 ATGGACATCTGTTAAAAAGGAGG - Intergenic
942326076 2:174778239-174778261 GTGGGATTCTGGAGAAAAGCCGG - Intergenic
942359297 2:175155213-175155235 ATGGATTTCTTGTGAAAAGTGGG - Intronic
1172039175 20:32031578-32031600 CTGGACTTCTGGGACAAAGCAGG - Exonic
1174726010 20:52862722-52862744 ATGGAGTTCTGGTGACTATCAGG + Intergenic
1174936201 20:54872606-54872628 ATGGCCTTGTGGTGAATATCAGG + Intergenic
1183342453 22:37289112-37289134 CTGGTCTTCTGGAGAAAAGATGG + Intronic
1184839526 22:47044312-47044334 AAGGACTCCTGGGGAAAGGCAGG - Intronic
1185082525 22:48717891-48717913 ATTCACTTCTGGTGACAACCTGG - Intronic
1185103462 22:48854067-48854089 ATGGTCTCATGGAGAAAAGCAGG + Intergenic
951223345 3:20092998-20093020 ATGGACTTTATGTGAAAAACTGG - Intronic
956929865 3:74030736-74030758 ATGGACATGTGGAGAACAGCAGG + Intergenic
961312161 3:126009571-126009593 ATAGACTTCTAATGAAAAGTAGG + Intronic
961848757 3:129793757-129793779 ACAGAGTTCTGATGAAAAGCAGG - Intronic
964123993 3:153217025-153217047 ATAGACTTCTGGTAATTAGCAGG - Intergenic
964949722 3:162275363-162275385 ATGGACTTCTTGTGACATTCAGG - Intergenic
967322453 3:188208138-188208160 ATGGATTTCTGGCGAAGATCCGG + Intronic
967334714 3:188330963-188330985 ATGGTCTTCTGGTGAAAGTAAGG - Intronic
968752678 4:2398353-2398375 AAGGACTTCTGCTGAAAAGAGGG + Intronic
971753153 4:30677012-30677034 TATGACTTCTTGTGAAAAGCTGG - Intergenic
974872591 4:67661152-67661174 ATGGACTTCTGGATTAATGCTGG + Intronic
977657517 4:99539006-99539028 AAGGACTTCTGCAGAAAAGTTGG - Intronic
980458844 4:133078455-133078477 GAGGACTTCTGGTGTTAAGCAGG + Intergenic
981161102 4:141499747-141499769 AAGGACTTCTGGACCAAAGCAGG + Intergenic
982864221 4:160489884-160489906 TTGGACTCCTTGTGAAAAACAGG + Intergenic
983824710 4:172244425-172244447 ATTGAATTCTGTTTAAAAGCTGG - Intronic
983879768 4:172919701-172919723 ATGGAAATATGGTAAAAAGCAGG + Intronic
984935717 4:184888017-184888039 ATCGACTGCTGGTGAAACCCAGG - Intergenic
986886467 5:12243193-12243215 ATGTTCTTGTAGTGAAAAGCAGG + Intergenic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
990362339 5:55033071-55033093 ATGGCCTTTTGATGAAGAGCTGG - Intronic
991385421 5:66083528-66083550 AAGGACATCTGGTTCAAAGCAGG + Intergenic
992426074 5:76658633-76658655 TTGGACTGCTGGTGAAGAACAGG + Exonic
994680578 5:102881846-102881868 ATGGACTTTGGGAGAAAAGGTGG - Intronic
995783826 5:115807095-115807117 ATGGAAATCAGGTGAAAAACAGG + Intronic
999370369 5:151051633-151051655 AGAGACTCCTGGTGAAATGCAGG + Intronic
1001053545 5:168431373-168431395 AAGGTCTTCTGGTGAAGGGCTGG - Exonic
1004268325 6:14169689-14169711 AATGAATTCTGGTGAAAAACTGG - Intergenic
1005431629 6:25763837-25763859 ATGGACTTCTGGGGGAAAAGGGG - Intronic
1008824877 6:55682138-55682160 ATGAACTGATGGTGAAAAGCTGG - Intergenic
1009592116 6:65686246-65686268 ATTGTCTTCTGGGGAAGAGCCGG - Intronic
1014511701 6:122330564-122330586 ATTGACTTATGATGAAAAGCAGG - Intergenic
1017650461 6:156576623-156576645 ATGGACTCTTGGGGAAAAGAAGG - Intergenic
1017715668 6:157211033-157211055 ATGGACTTCAGGGCAAAGGCTGG - Intergenic
1019135261 6:169903882-169903904 CTGGAATCCTGGTGAACAGCTGG - Intergenic
1020135841 7:5587405-5587427 ATGGACTTCTGGTTACAAGCAGG - Intergenic
1020713187 7:11635106-11635128 CTGCGCTTCTGGTGAACAGCTGG - Intronic
1023764336 7:43496763-43496785 AGTGACTTGCGGTGAAAAGCAGG + Intronic
1023949099 7:44827395-44827417 AAGGACTCCTCGTGAAGAGCAGG + Intronic
1027486386 7:78766793-78766815 ATGCACTTCTTCTGGAAAGCAGG + Intronic
1028967823 7:96822214-96822236 TTGGACTTCTGGAGATAAGGAGG - Intergenic
1032662826 7:134004667-134004689 ATGGCTTTCTGGTTAAAAGAGGG + Intronic
1038090789 8:24250692-24250714 GGGGATTTCTGGTGAATAGCTGG + Intergenic
1041158349 8:55011057-55011079 ATAGCCTTCTGGAGAAAACCTGG - Intergenic
1042218489 8:66450514-66450536 ATGGACTTCTGGTCATAAAGTGG + Intronic
1042846153 8:73171362-73171384 ATTAACTTCTGATGAAAAGGGGG + Intergenic
1045380787 8:101622839-101622861 GGGGACTTCTGGGGAAAAGTGGG - Intronic
1045611455 8:103847691-103847713 CTGGACATCTGGTGATAAGTTGG - Intronic
1047882155 8:129206891-129206913 ATGGAATCCTGGAGAAAAACTGG + Intergenic
1048294966 8:133207277-133207299 CTGGACTTCAGGGGAGAAGCAGG + Intronic
1055850391 9:80621361-80621383 ATGGATCTCTGGTGAAAAGAAGG + Intergenic
1056062684 9:82900297-82900319 ATGGACTTCTTGTGGCAAGTGGG + Intergenic
1056103459 9:83323072-83323094 ATGTACTTCTGGTGGAAATTTGG + Intronic
1058072106 9:100611738-100611760 ATGGAATACAGGTCAAAAGCAGG + Intergenic
1059085181 9:111293758-111293780 ATTGACTTTTGGTAAAAAGCAGG - Intergenic
1060113189 9:120921039-120921061 ATGGACTTCTGGTGAAAAGCTGG - Intronic
1060397938 9:123329208-123329230 ATGGACTTCTGGTGATCAATGGG + Intergenic
1062249032 9:135584913-135584935 ATGAACGTCCGGAGAAAAGCAGG - Intergenic
1187472533 X:19581935-19581957 GTGGACTTCTTGTGAAGAGCTGG - Intronic
1191241380 X:58192660-58192682 AAAGACTCCTGGTGAAAACCAGG + Intergenic
1193683881 X:84554017-84554039 ATGGAGATCTTGTGAAAAGTAGG - Intergenic
1197703686 X:129618462-129618484 ATGGCCTACTCGTGGAAAGCGGG - Intergenic
1199577788 X:149330940-149330962 GTGGATTTCTGGTGAAAATCGGG - Intergenic
1199587471 X:149431443-149431465 TTGGACTTCAGGTGAGAAGCTGG - Intergenic
1200249524 X:154545448-154545470 ATGGACTTCTTGGGGAAAACAGG - Intronic