ID: 1060113244

View in Genome Browser
Species Human (GRCh38)
Location 9:120921311-120921333
Sequence AAAGAAATGGGGCAATTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060113231_1060113244 17 Left 1060113231 9:120921271-120921293 CCTAGGAGTCCCCAGAACCTCTT 0: 1
1: 0
2: 0
3: 48
4: 250
Right 1060113244 9:120921311-120921333 AAAGAAATGGGGCAATTAACAGG No data
1060113238_1060113244 6 Left 1060113238 9:120921282-120921304 CCAGAACCTCTTAGGGGCTCGGA 0: 1
1: 0
2: 0
3: 1
4: 76
Right 1060113244 9:120921311-120921333 AAAGAAATGGGGCAATTAACAGG No data
1060113230_1060113244 18 Left 1060113230 9:120921270-120921292 CCCTAGGAGTCCCCAGAACCTCT 0: 1
1: 0
2: 1
3: 18
4: 184
Right 1060113244 9:120921311-120921333 AAAGAAATGGGGCAATTAACAGG No data
1060113236_1060113244 7 Left 1060113236 9:120921281-120921303 CCCAGAACCTCTTAGGGGCTCGG 0: 1
1: 0
2: 3
3: 4
4: 83
Right 1060113244 9:120921311-120921333 AAAGAAATGGGGCAATTAACAGG No data
1060113240_1060113244 0 Left 1060113240 9:120921288-120921310 CCTCTTAGGGGCTCGGATAGGAG 0: 1
1: 0
2: 1
3: 1
4: 48
Right 1060113244 9:120921311-120921333 AAAGAAATGGGGCAATTAACAGG No data
1060113235_1060113244 8 Left 1060113235 9:120921280-120921302 CCCCAGAACCTCTTAGGGGCTCG 0: 1
1: 0
2: 0
3: 5
4: 82
Right 1060113244 9:120921311-120921333 AAAGAAATGGGGCAATTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060113244 Original CRISPR AAAGAAATGGGGCAATTAAC AGG Intronic
No off target data available for this crispr