ID: 1060113328

View in Genome Browser
Species Human (GRCh38)
Location 9:120921995-120922017
Sequence CTTGGCTAGCAGCAATTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 164}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060113328_1060113336 26 Left 1060113328 9:120921995-120922017 CCTGGGAATTGCTGCTAGCCAAG 0: 1
1: 0
2: 1
3: 9
4: 164
Right 1060113336 9:120922044-120922066 GACATCAGGCTCCTGATCCCTGG No data
1060113328_1060113331 12 Left 1060113328 9:120921995-120922017 CCTGGGAATTGCTGCTAGCCAAG 0: 1
1: 0
2: 1
3: 9
4: 164
Right 1060113331 9:120922030-120922052 CAGAACCACCCCTGGACATCAGG No data
1060113328_1060113337 27 Left 1060113328 9:120921995-120922017 CCTGGGAATTGCTGCTAGCCAAG 0: 1
1: 0
2: 1
3: 9
4: 164
Right 1060113337 9:120922045-120922067 ACATCAGGCTCCTGATCCCTGGG No data
1060113328_1060113330 4 Left 1060113328 9:120921995-120922017 CCTGGGAATTGCTGCTAGCCAAG 0: 1
1: 0
2: 1
3: 9
4: 164
Right 1060113330 9:120922022-120922044 GAATTATGCAGAACCACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060113328 Original CRISPR CTTGGCTAGCAGCAATTCCC AGG (reversed) Intronic
901577341 1:10211048-10211070 CTAGGCCAGCAGCGAGTCCCGGG + Intronic
903574878 1:24333079-24333101 CTTGGCAAGAAGCCATTCCAGGG + Intronic
903875557 1:26471377-26471399 CTTGGCTAGCTCCAAGACCCTGG + Intergenic
905768582 1:40623172-40623194 CTTGGGATGCAGCAAGTCCCAGG - Exonic
906904334 1:49873029-49873051 CTTGTCTAGCTTCAATTCACAGG - Intronic
908775907 1:67639687-67639709 CTTGGGTAGCTGAAATTGCCGGG - Intergenic
912218811 1:107648543-107648565 CCTGGCAAACAGCTATTCCCAGG + Intronic
915476136 1:156153905-156153927 GTTGGTTATCAGCATTTCCCGGG - Intronic
916236100 1:162590490-162590512 CTCGCCTTCCAGCAATTCCCCGG + Exonic
916742965 1:167662300-167662322 GCTGGGTAGCAGCAATCCCCTGG + Intronic
917933373 1:179839661-179839683 CTGGGATAGCAGCAATTCCCAGG + Intergenic
918002694 1:180512576-180512598 CTTGTCTAGCAGGAAAGCCCTGG - Intergenic
920639701 1:207740647-207740669 CTTGTCTAGCAGGAAGGCCCTGG + Intergenic
922555398 1:226528577-226528599 ATTGGCTAGAAGCAAGTCTCAGG + Intergenic
1063285962 10:4688725-4688747 CCTGGCTGGCAGCAATAGCCTGG + Intergenic
1065004181 10:21364607-21364629 CTTGGGTGGCAGAATTTCCCAGG - Intergenic
1066001151 10:31105127-31105149 CCTGGCTAGCAGGAATATCCCGG - Intergenic
1068161500 10:53271291-53271313 CTTGTCTAGCAGGAAAGCCCAGG + Intergenic
1068870347 10:61936778-61936800 CTTGTCCAGCAGTAATTGCCAGG - Intronic
1070949657 10:80420544-80420566 GTTGGCAAGCAGCAATGCCAAGG - Exonic
1071049471 10:81428896-81428918 CTTCACCAGCAGCTATTCCCTGG - Intergenic
1071764727 10:88650288-88650310 CTTCACTTGCAGCAACTCCCAGG - Intergenic
1072396645 10:95049877-95049899 AATAGCTAGCAGCAATACCCAGG + Intronic
1072620813 10:97078160-97078182 CTTGGACATCAGGAATTCCCTGG - Intronic
1073327409 10:102650758-102650780 CTTGGCTCTTAGCCATTCCCTGG + Intronic
1073916004 10:108404155-108404177 CTTGGCCACCAGCAATTCATTGG - Intergenic
1076444937 10:130507766-130507788 CTTGGCTAGTATCAATGGCCGGG + Intergenic
1077714858 11:4570425-4570447 CTTGGATAGCAGCACTTCTCTGG + Intergenic
1077974781 11:7236609-7236631 CTTGGCCAAGAGGAATTCCCTGG - Intergenic
1081188985 11:40080514-40080536 CTTGTCTAGCAGAAAAGCCCTGG + Intergenic
1081629790 11:44681420-44681442 CGTGGCTAGAAGCAGTTTCCTGG - Intergenic
1085718228 11:78891310-78891332 CTAGGCAAGCAGCCATTCCTAGG - Exonic
1085838369 11:79980946-79980968 ATTGGTTAGGAGCAATTCACAGG - Intergenic
1087082599 11:94186401-94186423 CTTGGCTAGAATCAAGTCACAGG + Intergenic
1087402410 11:97684309-97684331 AATGGCAAGCAGCAATACCCAGG - Intergenic
1088997251 11:115011723-115011745 CATTGCTACCAGCAATTTCCAGG - Intergenic
1090641662 11:128734588-128734610 CTTGGTTTGCACCAATGCCCTGG + Intronic
1099741055 12:86634842-86634864 CTTGACTAGCAGCAAGTCATAGG + Intronic
1100239453 12:92696742-92696764 ATTGGTTAGAAGCAAATCCCAGG - Intergenic
1101919801 12:108923196-108923218 GTTGGCTAGAAGCAAGTCACAGG - Intronic
1111753937 13:92368566-92368588 CTTGGCTCACTGCAAATCCCAGG - Intronic
1112237731 13:97651285-97651307 CTTGTCTAGCAGGAAAGCCCTGG - Intergenic
1112358482 13:98694950-98694972 CTTGGCTCGCTGCACCTCCCAGG - Intronic
1115749527 14:36475404-36475426 GTTGGTTAGAAGCAAGTCCCAGG + Intronic
1116779886 14:49225316-49225338 ATTGGTTAGAAGCAATTCACAGG + Intergenic
1117620077 14:57576702-57576724 CTTGGATAGCAGCAAACCCAAGG + Intronic
1118031412 14:61821717-61821739 CTTGGCTAGTAGCAAGTCATAGG + Intergenic
1118453642 14:65926509-65926531 CTTGTCTAGCAGGAAAGCCCTGG + Intergenic
1121452037 14:94014878-94014900 CGTGGCTAGAGGCCATTCCCCGG + Intergenic
1121882278 14:97511576-97511598 CATGGCTACCAGCAACTCCTGGG - Intergenic
1122449997 14:101797984-101798006 GTTGGCAAGCAGAAGTTCCCTGG + Intronic
1123707542 15:22960801-22960823 CTTTCCTAGCAGCACATCCCAGG + Intronic
1123712049 15:22995478-22995500 CTTTCCTAGCAGCACATCCCAGG - Intronic
1123817491 15:23994591-23994613 CTTGTCTAGCAGGAAAGCCCTGG - Intergenic
1125538352 15:40455709-40455731 CTTGGCTCCCAGCCGTTCCCAGG + Intronic
1127489700 15:59450938-59450960 CTTGGTTAGAAGCAAGTCACAGG + Intronic
1130983475 15:88828914-88828936 CTAGGCTAGAAGCAACTCCAAGG + Intronic
1132515580 16:364268-364290 GGTGGCCAGCAGCCATTCCCAGG + Intergenic
1133639448 16:7702686-7702708 CTCGGCTTTCAGCAATTCTCAGG - Intronic
1133872056 16:9698172-9698194 ATTGGCTAGAAGCAAATCACAGG - Intergenic
1133872064 16:9698264-9698286 ATTGGCTAGAAGCAAGTCACAGG - Intergenic
1135208600 16:20504071-20504093 CTTGTCTCCCAGCTATTCCCTGG - Intergenic
1135230950 16:20707121-20707143 CTTGTCTCCCAGCTATTCCCTGG - Intronic
1140482912 16:75272141-75272163 CTTCGCTGGAAGCAATCCCCAGG + Intergenic
1141976486 16:87519569-87519591 CTTGGCTAGCTGGAATCCCCAGG - Intergenic
1143646865 17:8235868-8235890 CTTGCCTACCAGCAGTTCCGTGG - Exonic
1146603380 17:34237435-34237457 CTTGTCTACCAGCCAGTCCCAGG - Intergenic
1147160398 17:38566235-38566257 CTTGGCAGGCAGCAACCCCCAGG - Intronic
1150030969 17:61735217-61735239 GTTGGCTAGAAGCAAATCACTGG - Intronic
1151956119 17:77381078-77381100 CTTTGCAGGCAGCAGTTCCCTGG + Intronic
1152010289 17:77708999-77709021 CTTGGATGGTAGCAAGTCCCAGG - Intergenic
1154937781 18:21078486-21078508 CTTGTCTAGCAGGAAAGCCCGGG + Intronic
1155783124 18:29864336-29864358 CCTGTCTAGCATTAATTCCCTGG - Intergenic
1157180745 18:45495892-45495914 CTTGGCAAGCGCCAACTCCCAGG + Intronic
1164079808 19:21852234-21852256 CTTGATTAGCTGTAATTCCCTGG - Intergenic
1166225174 19:41390595-41390617 CTTGGGTAGCAGCCACTCCCCGG + Intronic
1166239493 19:41480333-41480355 CTTGTCTAGCAGGAAAGCCCCGG + Intergenic
1166242178 19:41501964-41501986 CTTGTCTAGCAGGAAAGCCCTGG + Intergenic
1166471452 19:43082682-43082704 CTGGGGCAGCAGCAATTCCCAGG + Intronic
1167627418 19:50601566-50601588 CTTGGCTTTCAGTACTTCCCAGG + Intergenic
925569702 2:5295807-5295829 CGTGGCTAACAGCACTTCGCAGG - Intergenic
926339907 2:11896348-11896370 ATTGGCTAACAGTCATTCCCTGG - Intergenic
927278380 2:21281031-21281053 CTTGCCAAGCACCAAGTCCCAGG - Intergenic
929952018 2:46418951-46418973 CTTGGCTAGCTGCAACCACCTGG - Intergenic
930097114 2:47573136-47573158 CTTGATTAGCAGCAAATCTCTGG + Intergenic
930574964 2:53135310-53135332 CTTGGTTAGAAGCAAATCCCAGG - Intergenic
931861316 2:66357588-66357610 CTTGGCTAGCTTCTTTTCCCTGG - Intergenic
934146983 2:89104696-89104718 CTTGTCTAGCAGGAAAGCCCTGG + Intergenic
934222283 2:90095899-90095921 CTTGTCTAGCAGGAAAGCCCTGG - Intergenic
934727967 2:96637485-96637507 CTTGGCCAGCACCACTTCCTAGG + Intronic
935982037 2:108636869-108636891 CCAGGCTAGCAGCATCTCCCAGG - Intronic
939117251 2:138074671-138074693 ATTGGTTAGAAGCAAGTCCCAGG + Intergenic
940903285 2:159146465-159146487 CTTGGGTAGCAGCAAAGTCCAGG + Intronic
941640483 2:167982725-167982747 CTTGGCTACCAGGTACTCCCAGG - Intronic
942873218 2:180761559-180761581 GTTGGCTCCCAGCAATTCACAGG + Intergenic
945318833 2:208397906-208397928 CTTGCCTAGCAGAAAAACCCTGG - Intronic
945811143 2:214551812-214551834 CTTGGCTGGGAGAAATACCCTGG - Intronic
1174969317 20:55255794-55255816 CTTGGCTCACTGCGATTCCCGGG + Intergenic
1177332649 21:19682762-19682784 CTTGTCTAGCAGAAAAGCCCCGG + Intergenic
1180253390 21:46605241-46605263 CCTGGCTCCCAGCAAGTCCCCGG - Intergenic
1180998729 22:19978105-19978127 CCTGGCTACCAGAAACTCCCTGG + Intronic
1183282726 22:36941028-36941050 CTTGTCTAGCAGGAAAGCCCCGG - Intergenic
951679771 3:25282681-25282703 CAAGCCTAGCAGCAATGCCCTGG - Intronic
953548698 3:43883898-43883920 GTGGGCTGGCAGCAAGTCCCTGG + Intergenic
954512136 3:51134710-51134732 TGTGGCTTGCAGCATTTCCCAGG + Intronic
956282162 3:67569448-67569470 CTTGGGCAGCAGCCATGCCCCGG - Intronic
957577213 3:82024449-82024471 CTTGATTAGCAGCATTTCTCTGG + Intergenic
960165331 3:114395052-114395074 ATTGTCTAACAGCAATTCCCAGG + Intronic
960204154 3:114874792-114874814 GTTGGCAAGCACCAATTCCTGGG - Intronic
960682502 3:120263807-120263829 CTTGTCTAGCAGGAAAGCCCCGG + Intronic
962450804 3:135515391-135515413 CTGGGCTCGCAGCAATACTCAGG + Intergenic
962812207 3:138969132-138969154 CTTGGACAGCAGCAAATCCATGG - Intergenic
967079458 3:186036010-186036032 CTTGGTTAGAAGCAAGTCCAGGG - Intergenic
968329354 3:197852260-197852282 CTTAGCTAGAAGCAAATCTCAGG - Intronic
970057837 4:11995254-11995276 CATGGCAAGCAGCTATTCCTTGG + Intergenic
970569794 4:17368535-17368557 GTTGGTTAGAAGCAATTCACAGG + Intergenic
973817769 4:54633928-54633950 CTTCGCTAGCACCAATTCTTTGG + Intergenic
975310532 4:72898562-72898584 CTTGTCTAGCAGGAAAGCCCTGG - Intergenic
975575397 4:75857617-75857639 CTTGGTTAGAAGCAAGTCACAGG + Intergenic
977027198 4:91834402-91834424 CTTCGCTAGGAGCTCTTCCCAGG - Intergenic
978057706 4:104293026-104293048 CTTGGCTAGCAAGATTTCTCTGG - Intergenic
987508038 5:18798407-18798429 CTTGTCTAGCAGGAAAGCCCGGG - Intergenic
988543199 5:32131087-32131109 CTTCTCTTGTAGCAATTCCCTGG + Intronic
993247007 5:85464235-85464257 CTTGTCTAGCAGGAAAGCCCCGG + Intergenic
993623300 5:90192968-90192990 AATAGCCAGCAGCAATTCCCAGG + Intergenic
993742851 5:91562033-91562055 ACTGACTAGCAGCAACTCCCAGG - Intergenic
997986425 5:138504920-138504942 CTTGGCAGGCAGGAATCCCCTGG + Intergenic
1004084476 6:12431601-12431623 CTTTGCAAACAGCAATCCCCAGG + Intergenic
1006927378 6:37664522-37664544 CTTGGCTAAAGGCAATTCCCTGG - Intronic
1010322363 6:74527350-74527372 CTTGGCTAGCCTCAAATTCCTGG - Intergenic
1011678331 6:89758150-89758172 CTTGGCTCACTGCAAGTCCCCGG - Intronic
1013631082 6:111986663-111986685 CTTGGCAAGTGGCATTTCCCTGG + Intergenic
1015170690 6:130249133-130249155 GTTGGGTATCAGAAATTCCCAGG + Intronic
1020651486 7:10882141-10882163 CTTGTCTAGCAGAAAAGCCCTGG + Intergenic
1021574713 7:22096640-22096662 CTTGTCTAGCAGAAAAGCCCTGG + Intergenic
1022183600 7:27945318-27945340 CATGCCCAGCACCAATTCCCTGG + Intronic
1026241441 7:68578940-68578962 CATGGAGACCAGCAATTCCCAGG - Intergenic
1027348119 7:77282724-77282746 CTTGGCTGGCAGTAATTTCTGGG - Exonic
1027692988 7:81371603-81371625 ATTGGCTAGCAGCAATAAACTGG + Intergenic
1034107403 7:148502060-148502082 CTTGTCTAGCAGGAAAGCCCCGG - Intergenic
1034736117 7:153431002-153431024 CTTGTCTAGCAGAAAAGCCCTGG + Intergenic
1036673756 8:10811852-10811874 CTTGGCTACAAGCAAGTTCCAGG + Intronic
1040673259 8:49717753-49717775 CTTGTCTAGCAGGAAAGCCCAGG + Intergenic
1041717323 8:60943954-60943976 CTTGGCTTGCAGCAACGTCCAGG + Intergenic
1041741767 8:61164366-61164388 CTTGTCTAGCAGGAAAGCCCTGG + Intronic
1042337552 8:67644429-67644451 CTTGGCTTGCAGGGATGCCCTGG + Intronic
1042901765 8:73735724-73735746 CATGGCCACAAGCAATTCCCTGG - Intronic
1044772812 8:95655071-95655093 GTTGGCTTGCAACAATACCCTGG - Intergenic
1047106944 8:121742997-121743019 CTAGGGGAGCAGCCATTCCCAGG - Intergenic
1047188364 8:122655928-122655950 GTTGGCTAGAAGCAAGTCACAGG - Intergenic
1049649010 8:143754996-143755018 CTTGGTTAGAAGCAAGTCACAGG + Intergenic
1049741332 8:144242445-144242467 CTTGGCCAGCACCAGCTCCCGGG - Exonic
1051500381 9:17770523-17770545 ATTGGTTAGCAGCAAGTCACAGG - Intronic
1053362199 9:37496313-37496335 TTTGGCCAGCACCCATTCCCAGG - Intronic
1060113328 9:120921995-120922017 CTTGGCTAGCAGCAATTCCCAGG - Intronic
1061144479 9:128789245-128789267 CTCGGCTCACTGCAATTCCCAGG - Intronic
1061860675 9:133467227-133467249 CCAGGCCAGCAGCAATTCCTGGG - Intronic
1186537769 X:10367661-10367683 CTTGGCCAGGCACAATTCCCAGG + Intergenic
1186806635 X:13146448-13146470 TTTGGCCAGAAGCAATTCTCTGG - Intergenic
1187931848 X:24300823-24300845 CTTGGCTAGCCTCAAACCCCTGG + Intergenic
1188553985 X:31391241-31391263 CTTGGGTTCCAGCAATTCTCCGG + Intronic
1188819212 X:34753235-34753257 ATTGGCTAGAAGCAAGTCACAGG + Intergenic
1192547148 X:72023617-72023639 CTTGGCTAGCTCCATTCCCCTGG + Intergenic
1193523685 X:82562295-82562317 CCTGGTTAGCTGCAATTCCTAGG - Intergenic
1197997566 X:132394793-132394815 CTTAGCTAGGAGAATTTCCCTGG - Intronic
1198633854 X:138673579-138673601 CTTGTCTAGCATAAAATCCCTGG - Intronic
1199018586 X:142848415-142848437 CTTGTCTAGCAGGAAAGCCCTGG + Intergenic
1200964140 Y:9020979-9021001 GTTGCCTAGCAACAAGTCCCTGG - Intergenic
1201548976 Y:15198635-15198657 GTTGGCTAGAAGCAAGTCACAGG - Intergenic
1201554329 Y:15253269-15253291 TTTGTCTAGCAGGAAATCCCTGG + Intergenic
1201862503 Y:18614999-18615021 CTTGTCTAGCAGCAAAGCCCTGG + Intergenic
1201870820 Y:18705381-18705403 CTTGTCTAGCAGCAAAGCCCTGG - Intergenic
1202060648 Y:20884469-20884491 CTTGTCTAGCTGCAAAGCCCAGG + Intergenic
1202061692 Y:20895978-20896000 CTTGTCTAGGAGGAAATCCCTGG + Intergenic
1202148974 Y:21827822-21827844 GTTGCCTAGCAACAAGTCCCTGG + Intergenic