ID: 1060113330

View in Genome Browser
Species Human (GRCh38)
Location 9:120922022-120922044
Sequence GAATTATGCAGAACCACCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060113328_1060113330 4 Left 1060113328 9:120921995-120922017 CCTGGGAATTGCTGCTAGCCAAG 0: 1
1: 0
2: 1
3: 9
4: 164
Right 1060113330 9:120922022-120922044 GAATTATGCAGAACCACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060113330 Original CRISPR GAATTATGCAGAACCACCCC TGG Intronic
No off target data available for this crispr