ID: 1060116161

View in Genome Browser
Species Human (GRCh38)
Location 9:120942644-120942666
Sequence AGCGTCTCAAAGGCCCACGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060116154_1060116161 -2 Left 1060116154 9:120942623-120942645 CCAAGCAGGCCCACCCTCCACAG No data
Right 1060116161 9:120942644-120942666 AGCGTCTCAAAGGCCCACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060116161 Original CRISPR AGCGTCTCAAAGGCCCACGC AGG Intergenic