ID: 1060116161 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:120942644-120942666 |
| Sequence | AGCGTCTCAAAGGCCCACGC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1060116154_1060116161 | -2 | Left | 1060116154 | 9:120942623-120942645 | CCAAGCAGGCCCACCCTCCACAG | No data | ||
| Right | 1060116161 | 9:120942644-120942666 | AGCGTCTCAAAGGCCCACGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1060116161 | Original CRISPR | AGCGTCTCAAAGGCCCACGC AGG | Intergenic | ||