ID: 1060116474

View in Genome Browser
Species Human (GRCh38)
Location 9:120945253-120945275
Sequence CTGCCTTCCTATATGCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060116474_1060116484 30 Left 1060116474 9:120945253-120945275 CCAGGCTGCATATAGGAAGGCAG No data
Right 1060116484 9:120945306-120945328 GCTCTGTTGTGGAACCCTCTTGG No data
1060116474_1060116478 -4 Left 1060116474 9:120945253-120945275 CCAGGCTGCATATAGGAAGGCAG No data
Right 1060116478 9:120945272-120945294 GCAGAGGAGCCTGGTGCTGCGGG No data
1060116474_1060116477 -5 Left 1060116474 9:120945253-120945275 CCAGGCTGCATATAGGAAGGCAG No data
Right 1060116477 9:120945271-120945293 GGCAGAGGAGCCTGGTGCTGCGG No data
1060116474_1060116480 19 Left 1060116474 9:120945253-120945275 CCAGGCTGCATATAGGAAGGCAG No data
Right 1060116480 9:120945295-120945317 TTCTAGCCCCAGCTCTGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060116474 Original CRISPR CTGCCTTCCTATATGCAGCC TGG (reversed) Intergenic
No off target data available for this crispr