ID: 1060116584

View in Genome Browser
Species Human (GRCh38)
Location 9:120946159-120946181
Sequence CACAGCCTCATACCTGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060116584_1060116587 8 Left 1060116584 9:120946159-120946181 CCTCTGTCAGGTATGAGGCTGTG No data
Right 1060116587 9:120946190-120946212 GTGTGTATGTGCATGTTTCTGGG No data
1060116584_1060116588 13 Left 1060116584 9:120946159-120946181 CCTCTGTCAGGTATGAGGCTGTG No data
Right 1060116588 9:120946195-120946217 TATGTGCATGTTTCTGGGACAGG No data
1060116584_1060116589 14 Left 1060116584 9:120946159-120946181 CCTCTGTCAGGTATGAGGCTGTG No data
Right 1060116589 9:120946196-120946218 ATGTGCATGTTTCTGGGACAGGG No data
1060116584_1060116586 7 Left 1060116584 9:120946159-120946181 CCTCTGTCAGGTATGAGGCTGTG No data
Right 1060116586 9:120946189-120946211 TGTGTGTATGTGCATGTTTCTGG No data
1060116584_1060116590 15 Left 1060116584 9:120946159-120946181 CCTCTGTCAGGTATGAGGCTGTG No data
Right 1060116590 9:120946197-120946219 TGTGCATGTTTCTGGGACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060116584 Original CRISPR CACAGCCTCATACCTGACAG AGG (reversed) Intergenic
No off target data available for this crispr