ID: 1060116587

View in Genome Browser
Species Human (GRCh38)
Location 9:120946190-120946212
Sequence GTGTGTATGTGCATGTTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060116584_1060116587 8 Left 1060116584 9:120946159-120946181 CCTCTGTCAGGTATGAGGCTGTG No data
Right 1060116587 9:120946190-120946212 GTGTGTATGTGCATGTTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060116587 Original CRISPR GTGTGTATGTGCATGTTTCT GGG Intergenic
No off target data available for this crispr