ID: 1060120732

View in Genome Browser
Species Human (GRCh38)
Location 9:120987193-120987215
Sequence AACTTCTTTCCTAAGAAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 212}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060120732_1060120740 23 Left 1060120732 9:120987193-120987215 CCTAACTTCTTAGGAAAGAAGTT 0: 1
1: 0
2: 1
3: 27
4: 212
Right 1060120740 9:120987239-120987261 GGCCATTGGCCTAGATGTTATGG No data
1060120732_1060120737 2 Left 1060120732 9:120987193-120987215 CCTAACTTCTTAGGAAAGAAGTT 0: 1
1: 0
2: 1
3: 27
4: 212
Right 1060120737 9:120987218-120987240 GCCTTGAGACATTGATTAGGGGG No data
1060120732_1060120735 0 Left 1060120732 9:120987193-120987215 CCTAACTTCTTAGGAAAGAAGTT 0: 1
1: 0
2: 1
3: 27
4: 212
Right 1060120735 9:120987216-120987238 AGGCCTTGAGACATTGATTAGGG No data
1060120732_1060120736 1 Left 1060120732 9:120987193-120987215 CCTAACTTCTTAGGAAAGAAGTT 0: 1
1: 0
2: 1
3: 27
4: 212
Right 1060120736 9:120987217-120987239 GGCCTTGAGACATTGATTAGGGG No data
1060120732_1060120739 9 Left 1060120732 9:120987193-120987215 CCTAACTTCTTAGGAAAGAAGTT 0: 1
1: 0
2: 1
3: 27
4: 212
Right 1060120739 9:120987225-120987247 GACATTGATTAGGGGGCCATTGG No data
1060120732_1060120734 -1 Left 1060120732 9:120987193-120987215 CCTAACTTCTTAGGAAAGAAGTT 0: 1
1: 0
2: 1
3: 27
4: 212
Right 1060120734 9:120987215-120987237 TAGGCCTTGAGACATTGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060120732 Original CRISPR AACTTCTTTCCTAAGAAGTT AGG (reversed) Intronic
900504086 1:3020585-3020607 CACTTTTTTCCTAAGGAGGTTGG - Intergenic
901172571 1:7270965-7270987 AACTTCTTGCATATAAAGTTAGG - Intronic
903253626 1:22075545-22075567 GAGTTCCTTTCTAAGAAGTTTGG + Intronic
903483363 1:23670721-23670743 AACATCTTTCTGTAGAAGTTCGG + Intergenic
908190675 1:61700511-61700533 CACTTCTTTCAGAACAAGTTGGG - Intronic
908540466 1:65117321-65117343 ATGTTCCTTGCTAAGAAGTTTGG + Intergenic
910399337 1:86823044-86823066 AAATGCTTTCCTAAGAAATACGG - Intergenic
911656593 1:100450819-100450841 GACTGCTCTCTTAAGAAGTTTGG - Intronic
914863086 1:151402547-151402569 ATTTTCTTTCTCAAGAAGTTTGG - Intergenic
916651372 1:166837807-166837829 AATTTCTTTTCTAAGATGCTGGG + Intergenic
917426600 1:174920866-174920888 AATTTCTTTCCTAACAGTTTTGG - Intronic
918311784 1:183290206-183290228 AACTTCTTTCCGATGATGTTAGG - Exonic
918628233 1:186682964-186682986 AACTTTTTTCCTAAGATGCTAGG + Intergenic
918842604 1:189561758-189561780 AGCATCTCTCTTAAGAAGTTTGG - Intergenic
918842689 1:189563713-189563735 AGCATCTCTCTTAAGAAGTTTGG + Intergenic
919334207 1:196211120-196211142 AACTTGTTTGGTAAGAAGTTTGG + Intergenic
921082963 1:211758176-211758198 AACTTCTTAGAAAAGAAGTTAGG - Intronic
921447238 1:215261117-215261139 AACTCCTATCATAAGAAGGTAGG - Intergenic
921499437 1:215882980-215883002 TACTACTTTCTTAAAAAGTTGGG + Intronic
921693803 1:218183880-218183902 ATCTTCTTTCCTATGTATTTAGG - Intergenic
924450177 1:244171478-244171500 AACTTCTATTCTAAGGAGCTTGG - Intergenic
924715431 1:246568541-246568563 ATCTTTTTTCTTAAGAAGTGTGG + Intronic
1063647645 10:7901494-7901516 AACTACTTTCCTTTGAAATTGGG + Intronic
1063760081 10:9064347-9064369 GACATCTTTCCTATGCAGTTGGG - Intergenic
1065290629 10:24226049-24226071 GATTTCTTAACTAAGAAGTTAGG + Intronic
1068333372 10:55601257-55601279 GAATTCTATCCTAAGAAGTTAGG + Intronic
1068966459 10:62916801-62916823 TACTCCATTCCTAAGAGGTTTGG + Intronic
1071264161 10:83949296-83949318 CACCTCTTTCCTAAAAGGTTGGG + Intergenic
1072020842 10:91398945-91398967 AACTGCTTTCATTATAAGTTTGG - Intergenic
1073368267 10:102963110-102963132 AACTTCTTTGATGAGAACTTTGG + Intronic
1074149153 10:110742595-110742617 AACTTCTGTACAAAGAAGTTCGG - Intronic
1074725922 10:116309698-116309720 AACATCTTTCATTAGAAATTTGG + Intergenic
1078168816 11:8912826-8912848 AACTTATTTGCTATGAAATTCGG - Intronic
1078504285 11:11919804-11919826 AACTGCTTTTCTTAGAAGTGTGG + Intronic
1078656011 11:13239949-13239971 AAAGTTTTTCCTAAGTAGTTGGG + Intergenic
1081007766 11:37768832-37768854 AATTTCTTTCCTTAGAATTCCGG + Intergenic
1081664141 11:44906663-44906685 AATGTCTCTCCTAAGAAGGTGGG - Intronic
1085047033 11:73359679-73359701 AACTTTTTTCCCAAGAGCTTGGG + Intronic
1086488392 11:87333230-87333252 AACTTCTATCTTAAGAAACTAGG + Intergenic
1087583301 11:100086947-100086969 AGCTTCTATCTTAAGAAATTAGG + Intronic
1088013183 11:105028219-105028241 ATCTTCTTTCAGAAGAAGCTTGG - Intronic
1088016307 11:105064541-105064563 ATCTTCTTTCAGAAGAAGTTTGG - Intronic
1088018865 11:105094521-105094543 ATCTTCTTTCAGAAGAAGTTTGG - Intronic
1090912836 11:131136367-131136389 AAATTCTTTTCTAGGAAGTTTGG + Intergenic
1092174394 12:6393264-6393286 AATTTCTTTTTTAAGAAGTGGGG + Intergenic
1092480998 12:8858882-8858904 AACTTCTTACAAAAGACGTTGGG - Intronic
1093257559 12:16888808-16888830 AACTACTGTCCTAAGAAACTTGG + Intergenic
1094375157 12:29782616-29782638 CTCTTCTTTCCTCAGAAGCTAGG + Intronic
1095213771 12:39525151-39525173 AATATCTTTCCTATGAAGTAGGG + Intergenic
1095284884 12:40398279-40398301 GTCTTCTTTGGTAAGAAGTTAGG - Intronic
1096915015 12:55021936-55021958 AATTTCTTTCCTAGGAATTGAGG + Intronic
1099084423 12:78227359-78227381 TTCCTCTTTCCTAAGAAATTGGG - Intergenic
1099645834 12:85354912-85354934 AACATCTCTTTTAAGAAGTTTGG + Intergenic
1106832435 13:33599489-33599511 AACTTCATTCCTAGGAGCTTAGG + Intergenic
1108214464 13:48170698-48170720 AGCTTCTATCTTAAGAAGCTAGG + Intergenic
1109063000 13:57644161-57644183 AGCAGCTTTCCTAAGAAGGTTGG - Intronic
1110068947 13:71148411-71148433 AACGTTTTTCTTAAGGAGTTGGG + Intergenic
1111215717 13:85138769-85138791 ACCTACTTTCCTAAGGATTTAGG - Intergenic
1115515293 14:34179290-34179312 AACTCCTTTCCCAAGAAGAAGGG - Intronic
1116536980 14:46043814-46043836 AAGTTCTATCCAAATAAGTTAGG - Intergenic
1116599016 14:46894852-46894874 AACTTGCTTCCTATCAAGTTTGG + Intronic
1117002003 14:51380014-51380036 AGCTCCTTTCCTAGGAATTTTGG - Intergenic
1117618678 14:57561558-57561580 AACTTCTTCCCTAAGAGGCTGGG - Intergenic
1117626103 14:57639804-57639826 AACTTCTGCCTTAGGAAGTTGGG + Intronic
1118840818 14:69509177-69509199 ATCTTCTTTGCTAAGATGTCTGG + Intronic
1119833870 14:77729295-77729317 AACTTTTATCCTAAGCAGTTGGG - Intronic
1121865953 14:97362967-97362989 ACCTTCTTTCATAGGAACTTAGG - Intergenic
1121871667 14:97413830-97413852 AACATCTTTACTTAGAACTTGGG - Intergenic
1122155245 14:99746762-99746784 AACTTCATGCCTAAGAAGGCTGG + Intronic
1125256839 15:37774315-37774337 ATCTTCTGTCTTAGGAAGTTTGG - Intergenic
1125443048 15:39723668-39723690 AAATTCTTTCTTAAGGAGTATGG + Intronic
1127939676 15:63682352-63682374 AACTTCTTTCCTGAGGAGAAAGG + Intronic
1129076993 15:73005455-73005477 AACTTCTTTCCTGAGCAGCGTGG + Intergenic
1129413401 15:75361871-75361893 AACTTCTTTCTGCAGGAGTTTGG - Exonic
1132076851 15:98828644-98828666 AATTTCTTGGCAAAGAAGTTGGG - Intronic
1132996166 16:2824490-2824512 ATCTTCTTTCCTCAGACGTCAGG - Intronic
1134527718 16:14957279-14957301 AACTTCTTGTCTTAGAATTTGGG + Intergenic
1136527303 16:30840162-30840184 AACCTGTTGCCTAAGAACTTAGG + Intronic
1140980217 16:80101603-80101625 AAATGCTGGCCTAAGAAGTTTGG - Intergenic
1142898349 17:2996473-2996495 TCCTTCTTTCCTAAGAAGCCAGG - Intronic
1143790024 17:9287365-9287387 AACATCTCTCCTGAGAAGATAGG - Intronic
1144035784 17:11364363-11364385 AGCTTCTTTCAAAAGAACTTTGG + Intronic
1147033248 17:37658943-37658965 AACCTATTTTCTAAAAAGTTGGG - Intergenic
1147653749 17:42076805-42076827 AACTTTTTTCCTACAAAGGTGGG + Intergenic
1149711334 17:58745123-58745145 AACTCCTTTCCTAAATAGCTGGG - Intergenic
1152585053 17:81185524-81185546 AGCATCCTTCCCAAGAAGTTAGG + Intergenic
1155112723 18:22732259-22732281 ACCTTCTTGCCTTACAAGTTTGG - Intergenic
1155780211 18:29822209-29822231 ATCTACTTTCCAAAGAACTTTGG + Intergenic
1156043377 18:32849862-32849884 TACTTCTTTCCTTAAAATTTGGG - Intergenic
1156632818 18:38990776-38990798 AAATTATTTCATAAGAACTTTGG - Intergenic
1157987266 18:52452375-52452397 AACTTCTTTCGGAATAATTTTGG - Intronic
1158433111 18:57409722-57409744 AACTCCCATCCCAAGAAGTTGGG + Intergenic
1163255523 19:16153652-16153674 AGCATCTTTCCTTAGAAGCTCGG + Intronic
925643016 2:6005507-6005529 AACTTATTTTCTCAGAAGTGTGG + Intergenic
926538195 2:14140674-14140696 AGCTCCTGTCCTTAGAAGTTGGG + Intergenic
926631031 2:15136479-15136501 AACTTTATTTATAAGAAGTTTGG + Intergenic
927374506 2:22397919-22397941 AACTTCATTCCTAACAAGTAAGG + Intergenic
928824725 2:35406101-35406123 AACTTCTTACCCAGGAAGGTGGG - Intergenic
929711553 2:44271773-44271795 AACTACTTTCCAAAACAGTTTGG + Intergenic
930760142 2:55025168-55025190 AGCTTCTTTCACAAGAACTTTGG + Exonic
931612601 2:64119184-64119206 AACTTCTTCCCTAAGATGGAAGG + Intronic
932198721 2:69807135-69807157 AAGTTCTTTTCCAAAAAGTTAGG + Intronic
932493166 2:72134095-72134117 AACTTCTTTCCTGGGGAGCTAGG - Intronic
934533023 2:95107598-95107620 CGCTGCTTTCTTAAGAAGTTTGG - Intronic
937728046 2:125190371-125190393 AACTTTTTACCTATAAAGTTGGG + Intergenic
939842369 2:147205072-147205094 GGCTTCTTTCAAAAGAAGTTGGG + Intergenic
940413475 2:153393412-153393434 TACTTGCTTCCTAAGAACTTAGG + Intergenic
940763860 2:157768537-157768559 AACTTCTTCCCTAAGACCTAAGG - Intronic
940831043 2:158466389-158466411 AATTTCTTTACTAAGGAATTTGG - Intronic
941868058 2:170355111-170355133 AGCTTTTTTGCTAAGAAGTTGGG + Intronic
942438200 2:176003670-176003692 ATCTCCTTTCCTAAGAAGACTGG + Intergenic
942511374 2:176706048-176706070 AAATTGTTTCCCAAGATGTTTGG - Intergenic
942904571 2:181165699-181165721 GACTTCTGTCCTCAGCAGTTGGG - Intergenic
943049968 2:182902382-182902404 AACTTCTGTCCCATGAAGTTGGG + Intergenic
944367598 2:198942385-198942407 ATCTTCTTTCCAAAGATGTTTGG - Intergenic
945747940 2:213742194-213742216 AATTTTTTCCCTAAGAATTTTGG + Intronic
947117497 2:226787443-226787465 AACTTATGTCATAAGAAATTTGG + Intronic
947237337 2:227955348-227955370 AACTGCTATACTAAGACGTTTGG + Intergenic
1168759974 20:343644-343666 AACTTGGTTACTAAGAAGTAAGG - Intergenic
1169135936 20:3197363-3197385 GACTTCTTTCCAAAGAAATACGG + Intronic
1170031872 20:11952603-11952625 AAATTCTTTATTAATAAGTTAGG + Intergenic
1170112093 20:12816431-12816453 AAGTTATTTACTAACAAGTTTGG - Intergenic
1177092664 21:16788757-16788779 AAACACTTTCCAAAGAAGTTCGG + Intergenic
1178882764 21:36461941-36461963 AACTGCTTTCCTGGGAAGGTGGG + Intronic
1181068600 22:20319026-20319048 AACTTCTAAAATAAGAAGTTTGG + Intronic
949215355 3:1560798-1560820 AATTTCTTTCCTAAGATTTTTGG + Intergenic
950090678 3:10292032-10292054 AACTGCTAGCCCAAGAAGTTTGG + Intronic
950348132 3:12318255-12318277 AACTTCTTTGCTATTAAGCTGGG - Intronic
955948890 3:64222346-64222368 AAATTCTTTCCCAAGAAACTCGG - Intronic
956948933 3:74257549-74257571 AACTTCTCTCCTTAGCAGCTGGG + Intergenic
957263077 3:77925267-77925289 AACATCTTTCATAAGAAACTGGG + Intergenic
958096326 3:88950154-88950176 AATTTCCTTCCTGAGAAGCTAGG - Intergenic
959768048 3:110057470-110057492 AAATTTTCTGCTAAGAAGTTTGG + Intergenic
961056210 3:123790809-123790831 AACCTCTTTCAGAAGAAGCTGGG + Intronic
961970789 3:130964645-130964667 AACATCTTTTCTAGAAAGTTTGG - Intronic
962813960 3:138981995-138982017 CACTTCTTGGCTAAGAACTTTGG + Intergenic
963087476 3:141451741-141451763 AATTTCATTCCGAAGAAATTCGG + Intergenic
963778789 3:149465991-149466013 AACTTCTTTAATAAAAATTTAGG + Intergenic
965239879 3:166182219-166182241 AACCTGCTTCCTTAGAAGTTGGG + Intergenic
966322678 3:178718432-178718454 AACTTTTTCTCTCAGAAGTTAGG + Intronic
966968792 3:185022820-185022842 TACTTCTTTCCTACTTAGTTTGG + Intronic
967444279 3:189547643-189547665 AACTTCTTTACCCAGAATTTGGG - Intergenic
968855185 4:3114796-3114818 AACTGTTCTCCTAAGAAATTAGG - Intronic
970009299 4:11441309-11441331 AACTGCTTTCCAAAGAAGTGAGG + Intergenic
970669273 4:18377484-18377506 AAATTATTTCCTAAGAAGAGGGG - Intergenic
971192993 4:24445544-24445566 AACATGTTTCCTGAGAGGTTTGG - Intergenic
972614215 4:40682769-40682791 AACTTCTTTACAAGGCAGTTGGG - Intergenic
972678064 4:41279208-41279230 AACTTCATTCCTTTTAAGTTAGG - Intergenic
974893664 4:67912501-67912523 AAGTAGTTTCCTAAGAAGTAGGG + Intronic
975075000 4:70195591-70195613 AACCTCTTTCCTAATCATTTAGG - Intergenic
975730884 4:77336129-77336151 AACTTCTCTCATGAGGAGTTTGG + Intronic
977609418 4:99016884-99016906 AACTTCTTTCATAAGGGGTTTGG + Intronic
977827755 4:101553523-101553545 AACATGTTTCTTAAGAAATTAGG + Intronic
979429754 4:120614771-120614793 AAATTCTTTCCTGAAAAGTGGGG + Intergenic
981174477 4:141665560-141665582 AAATTATTTCATAAGAAATTTGG - Intronic
981733193 4:147921583-147921605 AACTTCTATCCTAAAATGTGAGG + Intronic
981854827 4:149276274-149276296 AATTTCTTATCTAGGAAGTTAGG - Intergenic
982293955 4:153807609-153807631 GACTTCTATCCTAAGAAGAGTGG - Intergenic
985183204 4:187287982-187288004 AACATCTTTCATAAAATGTTGGG + Intergenic
987045032 5:14099732-14099754 ATCTTGTTTTCTAAGAGGTTTGG - Intergenic
987310563 5:16677715-16677737 AACTTATTTCTTAAGAAGCATGG + Intronic
987479433 5:18434110-18434132 AAATTCTTTGCAAACAAGTTTGG + Intergenic
988597196 5:32606091-32606113 AAATTCATACCGAAGAAGTTAGG - Intergenic
989560767 5:42847556-42847578 AACTGCTTTACTCAGAAGTCAGG + Intronic
991714202 5:69436462-69436484 AATTTTTTACCTGAGAAGTTAGG + Intronic
992261280 5:74973047-74973069 ATCTGATTTCCTAAGCAGTTTGG + Intergenic
993646030 5:90463668-90463690 AATTACTATCCTAAGAAGTTAGG + Intronic
994697247 5:103087626-103087648 AATTTATTTCCCAAGAAGTAGGG + Exonic
995169922 5:109095862-109095884 AATTTGTTTCCTGAGAAGTTTGG - Intronic
995801101 5:115996105-115996127 AACTTCTTTTGAAAGCAGTTGGG + Intronic
996011994 5:118490763-118490785 AACTTAGGTTCTAAGAAGTTAGG - Intergenic
998377413 5:141700328-141700350 AAAGCCTTTCCTAAGAAGTGAGG + Intergenic
999831050 5:155320483-155320505 AACTTCTTTCCTAAGAGCTTTGG - Intergenic
1003435519 6:6084547-6084569 AACATCATTCCAAAGAAGGTGGG + Intergenic
1004865211 6:19846547-19846569 ATGTTCTTTCCTAAGAAGTGGGG + Intergenic
1006596630 6:35197845-35197867 AACTTCTTTCTTCAGCAATTGGG + Intergenic
1007028816 6:38607429-38607451 AAGTTTTCTACTAAGAAGTTTGG - Intronic
1007055408 6:38878399-38878421 AACTTCTTCCTTAATAAGTTAGG + Intronic
1008306116 6:49902163-49902185 AACATCTTTCTCAAGAACTTTGG + Intergenic
1008490498 6:52082007-52082029 AATTTCTTTTCTAACCAGTTTGG + Intronic
1012114064 6:95271177-95271199 ATGTTCATTCATAAGAAGTTGGG + Intergenic
1012267790 6:97167580-97167602 ATATTCCATCCTAAGAAGTTTGG - Intronic
1013078565 6:106792376-106792398 GACTTCTTTCCTGAGAGCTTAGG - Intergenic
1014165590 6:118220837-118220859 ATCTTCATTCCAAAGAAGCTTGG + Intronic
1014384882 6:120787160-120787182 AACTTTTTTCTGAAGAACTTAGG - Intergenic
1014628878 6:123764971-123764993 AATTTCTTACCTAAGAAGTGTGG - Intergenic
1014975175 6:127871864-127871886 AAAATATTTCCTTAGAAGTTTGG - Intronic
1015148122 6:130010149-130010171 AACTTCTTGTTTATGAAGTTTGG + Intergenic
1016177863 6:141102059-141102081 ATTTTTTTTCCTAAGAAATTGGG - Intergenic
1016888325 6:148980486-148980508 AATTTCTTGCTTAAGAAGCTTGG + Intronic
1017687156 6:156925026-156925048 AACTTCTTTCCTACGAAAGAAGG + Intronic
1018483706 6:164217619-164217641 AATTTCTATGCTAAGCAGTTTGG - Intergenic
1019088823 6:169507156-169507178 ACTTTGTTTCCTAACAAGTTTGG + Intronic
1021229595 7:18070008-18070030 TACTTCTTTCCACTGAAGTTAGG + Intergenic
1021831029 7:24609761-24609783 AACTTCTTTCCAAAGACAGTGGG - Intronic
1021907933 7:25354280-25354302 AACTTCTTTGAGAAGAGGTTAGG - Intergenic
1023273283 7:38490235-38490257 AAGTGCTTTACTAAGTAGTTGGG - Intronic
1024766192 7:52663556-52663578 AAATTCTTTCCTAAAAAGATAGG - Intergenic
1028044729 7:86103908-86103930 ATCATCTTTCCTCAGTAGTTGGG - Intergenic
1030757301 7:113302724-113302746 ATTTTCTTTCATAAGAATTTAGG + Intergenic
1030860725 7:114623212-114623234 AACTTCTTTCCAATGATTTTAGG + Intronic
1031176711 7:118361768-118361790 AACTTCTTTGCTAAGGAATCCGG - Intergenic
1032171821 7:129591195-129591217 AGCTTCTTTCCTCCGTAGTTGGG - Intergenic
1032452502 7:132045397-132045419 AACTTAATTCCAAAGAAGCTTGG + Intergenic
1033512018 7:142068568-142068590 CACCTCTTTCCTAAGCAGTTTGG + Intronic
1033515098 7:142097514-142097536 AACCTCTTTCCTAAGTATTTTGG + Intronic
1034877398 7:154737691-154737713 AATTTCTTGCCTATGAAATTAGG + Intronic
1036164289 8:6418087-6418109 AACTTCTATACTCAGAATTTGGG + Intronic
1037216434 8:16457841-16457863 AACCTCCTTCCTAAGATCTTAGG - Intronic
1037291198 8:17350855-17350877 ATCTTCTTTCCTAAAATGTCTGG - Intronic
1039262150 8:35783311-35783333 GACTTCTTTGCTAAGAATATGGG + Intronic
1040450359 8:47539934-47539956 TACTTCTTTCTTTAAAAGTTGGG - Intronic
1041927880 8:63254891-63254913 AATTACTTTCCTAAGATATTTGG + Intergenic
1043746818 8:83884016-83884038 AACTGCTATACTAAGACGTTTGG - Intergenic
1045189390 8:99867978-99868000 TACATCTTTCCTCAGAAGTCAGG - Intronic
1046599480 8:116299534-116299556 AACCTCTTTCCTAAGGAAGTTGG - Intergenic
1046732156 8:117737352-117737374 AACATCTTTGCTAATAAGTAAGG - Intergenic
1048428296 8:134342987-134343009 AATTTCTTTCCAAAAATGTTTGG + Intergenic
1050062179 9:1720894-1720916 TCCTTCTTTCCCAAGAAATTTGG + Intergenic
1051405460 9:16733276-16733298 AACTTCTTTCCTCAGGAATATGG - Intronic
1051985543 9:23082074-23082096 ACTTTCTTTCCTAAGAAAGTAGG - Intergenic
1052062748 9:23981285-23981307 AACTTCTTTCAAATGGAGTTCGG - Intergenic
1052360995 9:27557316-27557338 TACTTCTTTCCTAATCAGTTGGG + Intronic
1053419836 9:37970327-37970349 ACTTTCATTCCTAAGAAGTTGGG + Intronic
1053577607 9:39368899-39368921 AACGTCTTTCCTAAGAAACGTGG + Intergenic
1053842113 9:42196851-42196873 AACGTCTTTCCTAAGAAACGTGG + Intergenic
1054099183 9:60927616-60927638 AACGTCTTTCCTAAGAAACGTGG + Intergenic
1054120580 9:61203240-61203262 AACGTCTTTCCTAAGAAACGTGG + Intergenic
1054587168 9:66979316-66979338 AACGTCTTTCCTAAGAAACGTGG - Intergenic
1055301571 9:74887991-74888013 ACCTTCTTTTCTAGGCAGTTAGG - Exonic
1055989748 9:82092617-82092639 AAATTTTCTCCTAAAAAGTTGGG - Intergenic
1059992248 9:119876133-119876155 AACTTGTTTCTTAAGAAATGGGG + Intergenic
1060120732 9:120987193-120987215 AACTTCTTTCCTAAGAAGTTAGG - Intronic
1060120733 9:120987196-120987218 AACTTCTTAGGAAAGAAGTTAGG + Intronic
1060608826 9:124941768-124941790 AACTTCCTTCCTAAGCAGAAAGG - Intronic
1062642611 9:137528304-137528326 AGCTTCTATCTTAAGAAGCTAGG - Intronic
1185747767 X:2585414-2585436 ACCTCCTTTCCCAAGAATTTGGG - Intergenic
1185829150 X:3282280-3282302 TAATTATTTCCTAAGAAGTATGG - Intronic
1188636678 X:32441306-32441328 TATTTCTTTCTTAGGAAGTTTGG - Exonic
1193780101 X:85690985-85691007 AACTTCAAACCTAGGAAGTTAGG - Intergenic
1202083654 Y:21111805-21111827 AATTTCTTCCCAAAGTAGTTTGG + Intergenic