ID: 1060120738

View in Genome Browser
Species Human (GRCh38)
Location 9:120987219-120987241
Sequence GCCCCCTAATCAATGTCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 63}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060120738_1060120746 29 Left 1060120738 9:120987219-120987241 CCTTGAGACATTGATTAGGGGGC 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1060120746 9:120987271-120987293 GCAATAATGAGACTGTACCAGGG No data
1060120738_1060120747 30 Left 1060120738 9:120987219-120987241 CCTTGAGACATTGATTAGGGGGC 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1060120747 9:120987272-120987294 CAATAATGAGACTGTACCAGGGG No data
1060120738_1060120744 7 Left 1060120738 9:120987219-120987241 CCTTGAGACATTGATTAGGGGGC 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1060120744 9:120987249-120987271 CTAGATGTTATGGAAATCATGGG No data
1060120738_1060120743 6 Left 1060120738 9:120987219-120987241 CCTTGAGACATTGATTAGGGGGC 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1060120743 9:120987248-120987270 CCTAGATGTTATGGAAATCATGG No data
1060120738_1060120745 28 Left 1060120738 9:120987219-120987241 CCTTGAGACATTGATTAGGGGGC 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1060120745 9:120987270-120987292 GGCAATAATGAGACTGTACCAGG No data
1060120738_1060120740 -3 Left 1060120738 9:120987219-120987241 CCTTGAGACATTGATTAGGGGGC 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1060120740 9:120987239-120987261 GGCCATTGGCCTAGATGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060120738 Original CRISPR GCCCCCTAATCAATGTCTCA AGG (reversed) Intronic
903446880 1:23428143-23428165 GCTCCCAAATCCTTGTCTCAGGG + Intergenic
905810718 1:40911129-40911151 TCCCCCAAAACACTGTCTCAAGG + Intergenic
906722415 1:48018556-48018578 CCCCCCTTATTAATGTCTCTGGG - Intergenic
910556611 1:88541546-88541568 GATCCCTAATGAATGGCTCAAGG - Intergenic
919859152 1:201727610-201727632 GCACCCAAATCCTTGTCTCAAGG - Intronic
924077746 1:240358759-240358781 TCCCCATAATCCATGTGTCATGG - Intronic
924128752 1:240883564-240883586 GCCCTCAAATCAATAACTCATGG + Intronic
1078375572 11:10790689-10790711 GCCCCCTAATCCTTCTGTCATGG - Intergenic
1082803242 11:57429757-57429779 CCCCTCAAAGCAATGTCTCATGG - Intergenic
1088593116 11:111420155-111420177 GCCCCTGAATCCAAGTCTCAAGG + Intronic
1089393531 11:118118163-118118185 GCCCACTGAACAAGGTCTCAGGG + Exonic
1099090019 12:78295041-78295063 GCCCCCTTATCAGTGTATCCTGG + Intergenic
1099367867 12:81791884-81791906 GTCACCTAATCATTGTCTCCAGG + Intergenic
1099552222 12:84061392-84061414 GGTCCCTTATTAATGTCTCAAGG - Intergenic
1115912567 14:38272646-38272668 GCTCCCAAATCCTTGTCTCAGGG - Intergenic
1119895847 14:78219349-78219371 TCACCCTATTCAATGTCTCCTGG - Intergenic
1119967031 14:78928191-78928213 GCTCCCAAATCCTTGTCTCAAGG + Intronic
1123011747 14:105352902-105352924 GCCCCCTCATCACTGTCCCCTGG + Intronic
1123011783 14:105352997-105353019 GCCCCCTCATCACTGTCCCCTGG + Intronic
1123011957 14:105353439-105353461 GCCCCCTCATCACTGTCCCCTGG + Intronic
1123035833 14:105471578-105471600 GCCCCCTTATCTTTGTCTCCTGG - Intergenic
1132647833 16:1007243-1007265 GCCCGCTAAGTCATGTCTCAGGG + Intergenic
1137429462 16:48406829-48406851 CCCCCCTAATCCATGGCTCTGGG + Intronic
1140820823 16:78661603-78661625 GCCCTGTAATAAATGTCTCTTGG + Intronic
1157662635 18:49459639-49459661 GCCCCCTAATCAGTCTATCCTGG + Intronic
1168225080 19:54988868-54988890 GCCCACTAACCTATGTTTCAAGG - Intronic
929990156 2:46780239-46780261 GCACCCGAATCCTTGTCTCAGGG + Intergenic
932257632 2:70301362-70301384 ACCCACTAATCAATGACTCAAGG + Intronic
946446511 2:219744654-219744676 TCTCCCTAATCCATATCTCAGGG + Intergenic
1169571222 20:6908257-6908279 GCACCCTGATGAATGTCTCTGGG + Intergenic
1178230432 21:30777481-30777503 GACCTATAATCAATGACTCAAGG + Intergenic
1181377484 22:22471447-22471469 GGCCCTTAATAAATGTTTCATGG - Intergenic
1184312936 22:43659959-43659981 GCTCCCTACTGCATGTCTCAGGG + Intronic
1184992757 22:48181938-48181960 AACCCCTAATCCATGGCTCAGGG + Intergenic
949817174 3:8070678-8070700 CCACCCTAAGCAATGGCTCAAGG + Intergenic
955328810 3:58030183-58030205 ACCCCATACACAATGTCTCAGGG - Intronic
955836655 3:63063110-63063132 GCACCTTAATCCTTGTCTCAGGG - Intergenic
957527552 3:81396340-81396362 GCCCACTAATATATCTCTCAGGG - Intergenic
960815059 3:121663653-121663675 GGCCCCTGAGCACTGTCTCAGGG + Exonic
960857484 3:122118105-122118127 TCTCTCTCATCAATGTCTCAGGG - Intronic
962365388 3:134775631-134775653 GCACCCTAATCTCTGTCTCAGGG + Intronic
964685423 3:159390832-159390854 GCCACATAAGCAATGCCTCAGGG + Intronic
966568937 3:181418322-181418344 GTCCCTTAATCTGTGTCTCAAGG + Intergenic
974324799 4:60399371-60399393 GCCCTCAAATCCTTGTCTCAGGG + Intergenic
975081571 4:70286354-70286376 GCCTCCAAATTAATGACTCAAGG + Intergenic
977429316 4:96911681-96911703 GCCCCTTAATCTCTGTCTCTTGG - Intergenic
983580043 4:169300395-169300417 GTGCCCTGATCAATGTCCCAGGG - Intergenic
985118612 4:186616639-186616661 GCCCCCAAAACAGTGTCTCACGG + Intronic
985969183 5:3361914-3361936 GCCCCTCAATCAATGTTTCAGGG - Intergenic
992617165 5:78555818-78555840 GCCCCTTCATCAAGGTCTCTGGG - Intronic
994804082 5:104420955-104420977 GCACCCAAATCATTGTCTCAAGG - Intergenic
997036010 5:130192554-130192576 GCCCCCTAAAGAATCTCTGAAGG - Intergenic
1007345645 6:41227892-41227914 GCCCTCTACAAAATGTCTCAGGG + Intergenic
1008786628 6:55175686-55175708 TCCCCCTAAACAATTTCTGAGGG + Intronic
1009051721 6:58283699-58283721 GCCCCCTTATCTATGTGCCATGG - Intergenic
1011184089 6:84655052-84655074 GCCCAATAATCTATGTCTTAAGG - Intergenic
1016837869 6:148497250-148497272 GCCACCTAAGCAATGGCTCCTGG - Intronic
1022970675 7:35514019-35514041 GCACCCTCATGAATGACTCATGG + Intergenic
1024949159 7:54840130-54840152 GCGTCTTAATCAATGTTTCAGGG - Intergenic
1028517828 7:91697866-91697888 GCCCCCAAATCCTTGTTTCAGGG + Intronic
1043111878 8:76195572-76195594 GCCCACTGCCCAATGTCTCATGG - Intergenic
1048716292 8:137273927-137273949 CCACCCCAATCAATTTCTCAAGG - Intergenic
1050572910 9:6960073-6960095 GACCCCTAAGGAATCTCTCAGGG - Intronic
1051333335 9:16045181-16045203 GCACTCAAATCATTGTCTCAGGG - Intronic
1055797172 9:79987700-79987722 GCCACCATATCAAAGTCTCATGG + Intergenic
1060120738 9:120987219-120987241 GCCCCCTAATCAATGTCTCAAGG - Intronic
1197162957 X:123344622-123344644 GCCCTCAAATCTTTGTCTCAGGG + Intronic
1197810926 X:130442212-130442234 GCCCCCTGTTTAATGTCTCTGGG + Intergenic
1200246772 X:154530690-154530712 GCCCCCAAATACATGTCTCCTGG + Intergenic