ID: 1060120740

View in Genome Browser
Species Human (GRCh38)
Location 9:120987239-120987261
Sequence GGCCATTGGCCTAGATGTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060120738_1060120740 -3 Left 1060120738 9:120987219-120987241 CCTTGAGACATTGATTAGGGGGC 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1060120740 9:120987239-120987261 GGCCATTGGCCTAGATGTTATGG No data
1060120732_1060120740 23 Left 1060120732 9:120987193-120987215 CCTAACTTCTTAGGAAAGAAGTT 0: 1
1: 0
2: 1
3: 27
4: 212
Right 1060120740 9:120987239-120987261 GGCCATTGGCCTAGATGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060120740 Original CRISPR GGCCATTGGCCTAGATGTTA TGG Intronic
No off target data available for this crispr