ID: 1060125601

View in Genome Browser
Species Human (GRCh38)
Location 9:121041621-121041643
Sequence CCAGAGGCTGGGACCTTCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 1, 2: 3, 3: 42, 4: 353}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060125601_1060125607 23 Left 1060125601 9:121041621-121041643 CCGAGGAAGGTCCCAGCCTCTGG 0: 1
1: 1
2: 3
3: 42
4: 353
Right 1060125607 9:121041667-121041689 AGACTGATGACCCTTAGTTGTGG No data
1060125601_1060125606 -4 Left 1060125601 9:121041621-121041643 CCGAGGAAGGTCCCAGCCTCTGG 0: 1
1: 1
2: 3
3: 42
4: 353
Right 1060125606 9:121041640-121041662 CTGGATATTACACTGCTTACTGG No data
1060125601_1060125608 24 Left 1060125601 9:121041621-121041643 CCGAGGAAGGTCCCAGCCTCTGG 0: 1
1: 1
2: 3
3: 42
4: 353
Right 1060125608 9:121041668-121041690 GACTGATGACCCTTAGTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060125601 Original CRISPR CCAGAGGCTGGGACCTTCCT CGG (reversed) Intronic
900093472 1:930582-930604 CCAGAGGTCTGCACCTTCCTGGG + Intronic
900724470 1:4206868-4206890 CCAGGAGCTGGGACCCTGCTAGG + Intergenic
900981815 1:6050046-6050068 CCCCAGGCTGGGCCTTTCCTGGG - Intronic
900991516 1:6100389-6100411 CCATAGGCTGGGACCTCCGTTGG - Exonic
901079574 1:6576331-6576353 CAAGGGCCTGGGGCCTTCCTGGG - Intronic
901210045 1:7519528-7519550 CCTCAGCCAGGGACCTTCCTTGG + Intronic
901443212 1:9292297-9292319 CCAGAGGCTGGGACCTGTTCAGG + Intergenic
901873181 1:12150519-12150541 GCAGGGTCTGGGACCTTCCAGGG + Intergenic
902608095 1:17580409-17580431 CTGGAGGCTGGGGCCTTTCTGGG + Intronic
903082336 1:20820527-20820549 CCTGAGGGTGGGGCCTTACTGGG - Intronic
903095260 1:20966120-20966142 ACAGAGACTGGGACTTCCCTCGG + Intronic
903177673 1:21590397-21590419 CCAGAGGCCGTGCCCCTCCTTGG - Intergenic
904125060 1:28232605-28232627 GCAGAGGCTGGGCCCTTCCTGGG - Intronic
904900644 1:33854580-33854602 GCAGCTGCTGGTACCTTCCTGGG + Intronic
906075156 1:43046637-43046659 CTGGAGGCTGTCACCTTCCTGGG - Intergenic
906298336 1:44662764-44662786 CCAGGGGATGTGACCTCCCTTGG - Intronic
906448361 1:45922649-45922671 CGAGGGGCAGGGGCCTTCCTAGG + Intronic
909054724 1:70807327-70807349 GCAGGGGCAGGGAGCTTCCTGGG + Intergenic
910072667 1:83237788-83237810 GCAGAAGATGGGACATTCCTGGG - Intergenic
911060570 1:93744459-93744481 AGAGAATCTGGGACCTTCCTTGG + Intronic
913221426 1:116663800-116663822 CTAGAGGCTGGTACCTGCATCGG + Intronic
915205352 1:154266564-154266586 CCAGAGCCAGGCACCTACCTGGG - Exonic
917837529 1:178953092-178953114 CCTGAGCTTGGGAGCTTCCTCGG - Intergenic
919804793 1:201375184-201375206 CCAGAGGCTGAGCCATTCCAAGG + Intronic
921927719 1:220726268-220726290 CCAGAGGCTGCCACATTCTTGGG + Intergenic
922882659 1:228992732-228992754 TGAGAGACTGGGACCTTCTTGGG - Intergenic
924578199 1:245299930-245299952 GGAGAGGCTGAGAGCTTCCTGGG + Intronic
1062829114 10:593569-593591 GCAGAGGCAGGGGCCCTCCTCGG + Intronic
1063662388 10:8043537-8043559 CCAGCCGCAGGGGCCTTCCTGGG + Intergenic
1063901278 10:10734799-10734821 GCTGAGGCTGGGACTGTCCTGGG - Intergenic
1064409079 10:15089591-15089613 TCAGAGGTTGGGGTCTTCCTAGG + Intergenic
1064822465 10:19353213-19353235 CCAGAGTCTGAGACCAACCTAGG - Intronic
1065756728 10:28937347-28937369 CTAGAGGCTGGGACTTTCTCTGG + Intergenic
1065997428 10:31071830-31071852 GCATAGGCTGGGACCTTCCTGGG + Intergenic
1067761037 10:49047336-49047358 GCTGAAGCTGGGACCTTCCCTGG + Intronic
1069727753 10:70592133-70592155 GCAGAGGCTGGAAAATTCCTTGG + Intergenic
1069941973 10:71962765-71962787 CCAGAGCCTGTCCCCTTCCTGGG + Intergenic
1070659547 10:78294682-78294704 TCGGAGCCTGGGACCTTCCGTGG + Intergenic
1072139002 10:92573693-92573715 CCAGAGTCGGGGACGTCCCTTGG - Intronic
1072237459 10:93465859-93465881 CCACAGCCTGGGAACTCCCTGGG - Intronic
1072634577 10:97169624-97169646 CTCGAGGCTGGGACCTGCCCAGG - Intronic
1073496772 10:103898793-103898815 CCAGATGCTGGGATCGGCCTAGG - Intronic
1074825991 10:117216235-117216257 CCTGAGTCTGGGAGCTTCCGGGG - Intergenic
1075724226 10:124603443-124603465 CCCCTGGCTGGGACCTCCCTTGG - Intronic
1076206816 10:128610375-128610397 CCATAAGCTGGGCCATTCCTTGG - Intergenic
1076413944 10:130271591-130271613 ACAGAGCCTGGGAGCCTCCTGGG - Intergenic
1077080909 11:724394-724416 CCAGAGCCAGGGGCGTTCCTGGG - Intronic
1077339767 11:2021110-2021132 CCTGAGGCTGGGAGCTGCCTCGG - Intergenic
1078709333 11:13775804-13775826 CCAGGGGCTGGTTCCTTCTTAGG + Intergenic
1079882356 11:25943902-25943924 CCTGAGGGTGGGGCCTTACTGGG + Intergenic
1080279890 11:30544893-30544915 CCGGAAGCTGGGACCTCACTTGG + Intronic
1080896590 11:36453481-36453503 CTAGAGGCAGGGACTGTCCTAGG - Intronic
1081159067 11:39731664-39731686 CCAGAGAGAGGGAACTTCCTGGG - Intergenic
1081355869 11:42112938-42112960 CTACAGGCTGAGAGCTTCCTGGG - Intergenic
1082259349 11:50065655-50065677 CCAGAGGCTGGGAACTGCAGTGG - Intergenic
1082611253 11:55300797-55300819 CCAGAGGCTGAAACTTTCTTTGG - Intergenic
1082988752 11:59189315-59189337 CAAGAGGCTGGTACCTTTCTTGG - Exonic
1083547273 11:63558316-63558338 CCAGAGGCTGGGTCCCTGCTGGG - Intronic
1083574856 11:63782938-63782960 CCAGAGTCTGAGACCATCCTGGG + Intergenic
1083781653 11:64921509-64921531 CCAGAGGGTGGGCCATCCCTGGG - Intronic
1084467804 11:69336660-69336682 CCAGAGGTTGAGACCAGCCTGGG - Intronic
1084473906 11:69378096-69378118 CCCAGGGCTGGGACCTGCCTGGG + Intergenic
1084648537 11:70474649-70474671 CCAGTGGCTGTGGCTTTCCTAGG - Intronic
1084688677 11:70712128-70712150 CCAGAGGCTGCGGTGTTCCTCGG + Intronic
1085640648 11:78190597-78190619 CACCAGGCTGGGACCTCCCTTGG - Intronic
1088193042 11:107247256-107247278 CCACAGGCCAGGCCCTTCCTTGG + Intergenic
1088823872 11:113477534-113477556 CCAGAGGCTCCCAGCTTCCTGGG + Intergenic
1089160910 11:116436479-116436501 CCAGAGGCTGAGTCCTGCGTGGG + Intergenic
1089643952 11:119865706-119865728 ACAGAGGCTGGGCCCTCCCCTGG + Intergenic
1090258670 11:125303436-125303458 CCCGAGCCTGGGGCCTGCCTGGG - Intronic
1090777635 11:129979377-129979399 CCAGAGGCTGGGTGGATCCTGGG - Intronic
1090889911 11:130914706-130914728 CCAGAGCCTGGGAACTCTCTAGG + Exonic
1090912963 11:131137540-131137562 CCTGTGGCTGTGACCTTCTTTGG + Intergenic
1202822752 11_KI270721v1_random:76299-76321 CCTGAGGCTGGGAGCTGCCTCGG - Intergenic
1092940201 12:13401054-13401076 CCAGAGGCTGCTGCCTTCCTTGG - Intergenic
1096159964 12:49367741-49367763 CCAGAGGGTGGAAGGTTCCTGGG + Intronic
1096580719 12:52583010-52583032 ACAGAGGCTGGGGCCAGCCTGGG + Intergenic
1100358017 12:93850043-93850065 CCAGAGGCTGGGCCCTGAGTGGG + Exonic
1100360296 12:93871563-93871585 CCAGAGGCTGGGAAGGTCGTGGG - Intronic
1101301101 12:103483428-103483450 CCTGAGGCTGGATCCTTTCTGGG - Intronic
1103792178 12:123479543-123479565 CCAGAGGCTGGGAGGGGCCTGGG - Intronic
1103976780 12:124707805-124707827 CAACACGCTGAGACCTTCCTCGG + Intergenic
1103997028 12:124836944-124836966 CCAAAGGCTGGGCACTGCCTTGG + Intronic
1104007137 12:124901266-124901288 CCAGAGTTTGGGACCAGCCTGGG + Intergenic
1104588351 12:130064978-130065000 CCACAGGCAGGCAGCTTCCTTGG + Intergenic
1104816719 12:131650410-131650432 CCAGAGGCAGGAACCTCACTGGG + Intergenic
1106070580 13:26407260-26407282 ACAGAGGCTGGGACCAACCAGGG - Intergenic
1106355042 13:28973770-28973792 GGAGAGGCTGGGATCTTTCTAGG + Intronic
1106407674 13:29488001-29488023 CACGAGGCTGGGAGCTACCTTGG - Exonic
1106572001 13:30935284-30935306 TCAGAGGGTGGGGCCTTACTGGG - Intronic
1106576337 13:30979083-30979105 CCTGAGGGTGGGCCCTTACTGGG + Intergenic
1106680412 13:32001501-32001523 CCTGAGGCTGGGAGCTGCTTGGG + Intergenic
1106914702 13:34500011-34500033 ACAGAGGCTGAGACCTTCAGAGG + Intergenic
1108499695 13:51058825-51058847 CCAGCTGCTGGAACCTTCATTGG - Intergenic
1110439595 13:75512951-75512973 CCAGAGTTTGAGACCATCCTGGG - Intergenic
1112971411 13:105267205-105267227 CCAGTGGCTGGGACCATCCAGGG - Intergenic
1113711028 13:112465751-112465773 CCAGAGGCTGGAAACAGCCTTGG + Intergenic
1113935125 13:113989822-113989844 CCATATGCAGTGACCTTCCTGGG - Intronic
1114255481 14:20998258-20998280 CCAGAGGCCAGGACTTCCCTAGG + Intergenic
1114484273 14:23053792-23053814 CAAGAGCCTGGGACCTGCCCTGG - Intronic
1115089501 14:29556996-29557018 CCCCAGGCAGGGACCTTTCTGGG + Intergenic
1115310673 14:31975048-31975070 GCAGGGGCAGGGAGCTTCCTGGG + Intergenic
1118709900 14:68510467-68510489 CCAGAGGCTGGCCGCTGCCTTGG - Intronic
1118808344 14:69256687-69256709 CCAGAGGCAGAGAGCTCCCTGGG + Intergenic
1119100002 14:71870909-71870931 GCAGAGGCTTGGAACTTTCTGGG + Intergenic
1119545340 14:75467797-75467819 CCACAGGCTGGGACGTGACTGGG - Intronic
1120085132 14:80263345-80263367 CCAGAGGCTTGGAGACTCCTAGG + Intronic
1121114178 14:91331901-91331923 CCAGAGGCAGAGACCTACCTGGG - Intronic
1122152664 14:99733173-99733195 CCAGAGCCAGTGCCCTTCCTGGG - Intergenic
1122275943 14:100590886-100590908 CCTGGGCCTGGGACCTGCCTCGG - Intergenic
1122692362 14:103537450-103537472 CCAGGGTCTGGGACCTTCCAGGG - Intergenic
1122771201 14:104098701-104098723 CCGCAGGCAGAGACCTTCCTGGG - Intronic
1122776479 14:104119153-104119175 GCAGAGGCTGGGGGCTTCCCTGG - Intergenic
1123040002 14:105486591-105486613 GCAGAGGCGGGGACGTCCCTTGG + Intergenic
1123057378 14:105577746-105577768 CCAGAGGCTTGGACATGCCGTGG + Intergenic
1123502062 15:20896376-20896398 CCAGAGTTTGAGACCTGCCTGGG + Intergenic
1123723640 15:23081596-23081618 GCTGATGCTGGGATCTTCCTAGG + Intergenic
1124069658 15:26379655-26379677 CTAGAGGCTGCCACGTTCCTGGG + Intergenic
1124937555 15:34186837-34186859 CCTGAGGGTGGGGCCTTACTGGG - Intronic
1125485501 15:40108464-40108486 CCAGAGGCTGGGCCGTTCTCGGG + Intronic
1126610159 15:50520810-50520832 CCAGAGGCTGGGAACAACTTGGG + Intronic
1126872388 15:53003436-53003458 CCAGTGGCTTGGTTCTTCCTGGG + Intergenic
1127485423 15:59413709-59413731 CCAGAGTCTGAGACCAGCCTGGG + Intronic
1127715205 15:61643033-61643055 CAGGAGGCTGGCACCATCCTGGG - Intergenic
1129072390 15:72962131-72962153 CCAAAGACCGAGACCTTCCTAGG + Intergenic
1129176911 15:73846940-73846962 CTAGAGGCTGCTACATTCCTTGG - Intergenic
1129672123 15:77613276-77613298 ACAGAGGCTGGGGTCCTCCTGGG - Exonic
1131453570 15:92565778-92565800 CCAGAGGATGGGAACATCCCAGG - Intergenic
1131809920 15:96162439-96162461 CCAGAGGTTGGGATCTACCTTGG - Intergenic
1133285934 16:4690801-4690823 CCAGAGGCTGGGGCCTTGGTGGG - Exonic
1133816236 16:9199451-9199473 CAAGATGCTGGGAACTTCCTGGG + Intergenic
1133999102 16:10768831-10768853 CCAGTGGCTGCGGCCTTCCTCGG - Exonic
1134110203 16:11510606-11510628 CCTGAGGCTGACACCCTCCTGGG - Intronic
1134420342 16:14081788-14081810 CCAGAGTCTGAGACCAGCCTGGG - Intronic
1135241809 16:20813848-20813870 CCAGAGTCTGAGACCAGCCTGGG + Intronic
1136527020 16:30837859-30837881 CCAGTGGCTGGCACCTTGTTGGG - Intronic
1136714310 16:32264563-32264585 TCAGAGGCTGGCTCCTGCCTGGG + Intergenic
1137717523 16:50607865-50607887 CCACAGGCTGGGAAATTTCTAGG - Intronic
1138121756 16:54405865-54405887 CAAGGGGCTAGGACCATCCTGGG - Intergenic
1138747505 16:59380723-59380745 TCAAAGGCTAGGTCCTTCCTAGG + Intergenic
1139923302 16:70472764-70472786 CCAGAGACTGGGAGCTGCCCGGG - Intronic
1139968092 16:70756629-70756651 GCAGAGGCTGGGACAGCCCTTGG + Intronic
1140889591 16:79273586-79273608 CTAGAGGCTGCAACATTCCTTGG + Intergenic
1141391918 16:83671967-83671989 CCAGAGACCAGGACCTTCATGGG + Intronic
1141661304 16:85443115-85443137 CCTTAGGCTAGGACCTTACTGGG - Intergenic
1141990573 16:87607016-87607038 CCAGAGCCTGGGCCTTTGCTAGG + Intronic
1142127242 16:88416272-88416294 CCAGAGGCCGTGACCTTCTCAGG + Intergenic
1142195997 16:88739584-88739606 CGAGAGGCTGTGACTTGCCTCGG - Intronic
1142264135 16:89055754-89055776 GCAGAGGCTGAGCCCGTCCTGGG + Intergenic
1143040868 17:4035549-4035571 CCAGAGGCCTGGGCATTCCTGGG - Intronic
1143095379 17:4476018-4476040 CCAGAGGCGGGGACCACCCCAGG + Intronic
1143616222 17:8051522-8051544 CCAGATGCCTGGAGCTTCCTGGG - Intergenic
1143943537 17:10568591-10568613 CCTAAGGCTGGGACCTGGCTGGG + Intergenic
1144200278 17:12934836-12934858 ACCTGGGCTGGGACCTTCCTTGG + Intronic
1144761890 17:17711698-17711720 TCAAAGACTGGGACCTTCCCAGG - Intronic
1144945464 17:18967438-18967460 GCAGAGGCTGGGATGTTCCAGGG + Intronic
1146184065 17:30713547-30713569 CCACAGGCTTGGACTGTCCTGGG + Intergenic
1146257807 17:31401687-31401709 CCTTAGACTGGGATCTTCCTGGG - Intronic
1146259972 17:31414790-31414812 CCTGAGGCGGGGTCCTTCATTGG + Intronic
1146654098 17:34625233-34625255 CCAGAAGTTGGCAGCTTCCTTGG + Intronic
1148233041 17:45949215-45949237 GCGGAGCCCGGGACCTTCCTTGG + Intronic
1148339348 17:46864071-46864093 CCAGAGGCCTGGCCCTTCCAGGG + Intronic
1148644228 17:49210278-49210300 GCAGAGGGTGGGGGCTTCCTTGG - Exonic
1149088672 17:52751439-52751461 CCTGAGGGTGGGGCCTTACTGGG - Intergenic
1149160444 17:53686972-53686994 CCTGAGGATGGGGCCTTACTGGG + Intergenic
1150469031 17:65420276-65420298 CCAGTGACCGGGACCTTTCTGGG + Intergenic
1151386223 17:73757017-73757039 CAAGAGGCTGGTCCCTTCCCAGG + Intergenic
1152533917 17:80939623-80939645 AGAGAGTGTGGGACCTTCCTGGG - Intronic
1152573429 17:81130266-81130288 CCTCAGGCTGGAAGCTTCCTGGG + Intronic
1152608430 17:81304303-81304325 CCACAGGCTGAGATCATCCTTGG - Intergenic
1152755233 17:82084439-82084461 CCAGCAGCTAGGACCTGCCTGGG - Intronic
1152840101 17:82561787-82561809 CCACAGGCTGGACCCTTCTTGGG + Intronic
1153238792 18:3012962-3012984 CCGGAGGCCGGGACCCTCCGGGG - Intronic
1153656703 18:7289137-7289159 CCAGAGACTGGGAACTCCCAGGG + Intergenic
1153993647 18:10421616-10421638 CGAGAGGCTGCCACATTCCTTGG + Intergenic
1154949896 18:21199820-21199842 CCAGAGCCTGGAACTTTCTTGGG - Intergenic
1155044107 18:22088690-22088712 GCAGAGGCTGGGACCGCCGTGGG + Intronic
1157285027 18:46371882-46371904 ACATAGGCTGGGACATTCATGGG + Intronic
1157330501 18:46700591-46700613 CGAGAGGCTGGGCTGTTCCTGGG - Intronic
1157662465 18:49457929-49457951 CTAGAGGCTGCCACTTTCCTTGG - Intronic
1158401738 18:57127420-57127442 CCAGAGGCAGGATCCTTCCATGG + Intergenic
1159918032 18:74203310-74203332 CCAGGGGCTGGTTCCTTCCGAGG + Intergenic
1160292802 18:77609446-77609468 CCTGAAGGTGGGACCTTACTGGG - Intergenic
1160493176 18:79354836-79354858 GGAGAGGCTGGGACCTCGCTGGG - Intronic
1161027501 19:2043265-2043287 CAAGAGGGTGGGCCCCTCCTAGG - Intronic
1161551424 19:4914969-4914991 CCTCTGGCTGGGACCGTCCTGGG + Intronic
1161643128 19:5436518-5436540 CCAGGCGAGGGGACCTTCCTGGG + Intergenic
1162974717 19:14202135-14202157 CCACAGGCTTGGACTGTCCTGGG - Intronic
1164289492 19:23854400-23854422 GAAGAGGCTGGGACCCACCTGGG + Intergenic
1164739927 19:30568285-30568307 CCAGAGGTTGGGAGTTTCCGGGG + Intronic
1165026979 19:32969426-32969448 CCTGAGGGTGGGGCCTTACTGGG + Intronic
1165183436 19:33994244-33994266 CCAGAGGCTGGGAACGTAGTGGG + Intergenic
1165465821 19:35974203-35974225 CCAGAGGCTGTCCCCTTCCAGGG - Intergenic
1165602370 19:37065502-37065524 CAAGAGGCTGCCACATTCCTTGG - Intronic
1165707297 19:37985793-37985815 CCAGAGGCCGGGCCCCTCCCTGG + Intronic
1167030140 19:46953432-46953454 CCAGAGGCCAGGACATTCCTGGG + Intronic
1167437144 19:49486087-49486109 CTAGAGGCCGGTCCCTTCCTTGG + Exonic
1168020820 19:53607347-53607369 CCAGAGGTTGAGACCAGCCTGGG + Intergenic
1168465998 19:56601622-56601644 CCAAAGGCTGGATCCTGCCTTGG + Intronic
925272858 2:2626959-2626981 TGAGAGGCAGGGACCTTTCTGGG - Intergenic
925458879 2:4042994-4043016 CCTGTGGCTGTGACCTTCTTTGG + Intergenic
926002827 2:9347564-9347586 CCAGAGGCTGCCAGCTTCCTGGG - Intronic
927297983 2:21477081-21477103 CCAGGGCCTGGAACATTCCTAGG - Intergenic
928379293 2:30803844-30803866 CAAGAGGCTGGGAGACTCCTTGG + Intronic
928967612 2:36992932-36992954 CCAGAAGTTCGGACTTTCCTGGG - Intronic
929458721 2:42085555-42085577 CCAGAAGCTAGGTCCTGCCTGGG - Intergenic
929552688 2:42904502-42904524 CCAAATGCTGGGACTATCCTGGG - Intergenic
929597676 2:43186629-43186651 CCACAGGCTAGGAGCTTCCAGGG - Intergenic
930030890 2:47057391-47057413 CCAGAGGCCAGGGCCTTGCTGGG - Intronic
930807660 2:55507440-55507462 CAAGAGTTTGGGACCCTCCTGGG - Intergenic
932593050 2:73078603-73078625 CCAGTGGATTGGACATTCCTTGG + Intronic
932754904 2:74400602-74400624 CCAGAGTTTGAGACCATCCTGGG + Intergenic
933042495 2:77487280-77487302 GCAGAGGCAAGGAGCTTCCTGGG - Intronic
933280969 2:80332308-80332330 CCAGAGGCTGCCAGCTTCATGGG - Intronic
934521619 2:95023689-95023711 CCAGAGGCTGGGCTCTGCTTGGG + Intergenic
934652850 2:96102115-96102137 CCAGAGGCTGGGGGCTTCCAGGG + Intergenic
935825326 2:106942214-106942236 CTGGAGGTTGGGACCATCCTGGG - Intergenic
935986349 2:108677155-108677177 CCAGAGGCTGGGTCCAGTCTGGG - Intronic
937059531 2:118971032-118971054 CCAGAGGCTGTGGCCTCCCCAGG + Intronic
937217495 2:120321906-120321928 CCTGAGCCGGGGGCCTTCCTGGG + Intergenic
937353481 2:121183673-121183695 CCAGAGGCTGGGAACATACAAGG + Intergenic
937444599 2:121947078-121947100 GCAGAGGTTGGGAACTTCCCTGG - Intergenic
937710148 2:124971433-124971455 GCAGAGGCTGGGAGATACCTTGG - Intergenic
940922261 2:159321747-159321769 CCAGAGGCTGGGAACTGCAGTGG + Intronic
944109935 2:196121369-196121391 CCAGAGTTTAGGACCTGCCTGGG - Intergenic
944789542 2:203110462-203110484 CAAGAGTTTGGGACCATCCTGGG + Intronic
944890461 2:204111755-204111777 CAAAGGGCTGGGACCTTCCTTGG - Intergenic
947096809 2:226575881-226575903 CCAGAGGCTGGGATATCCCAAGG + Intergenic
948562633 2:238864628-238864650 CCAGAGGCTGGTACCCTCCGAGG + Intronic
948665714 2:239533592-239533614 CAAGAGGCAGGGACTTGCCTGGG - Intergenic
948892880 2:240915782-240915804 TCAGGGGCTGTGACCTCCCTGGG + Intergenic
949050326 2:241894490-241894512 CCAGCAGCTGTGACCTTGCTGGG + Intronic
1168806417 20:674880-674902 CCAAAGGCTGGGCCTGTCCTGGG - Intronic
1170108516 20:12779191-12779213 CCAGAGGCTGACACATTCCTTGG + Intergenic
1170596071 20:17806869-17806891 CCAGAGGGTGGGAGCTGCGTGGG + Intergenic
1170794216 20:19532384-19532406 CCAGAGGCTGAGACAGTCCTGGG - Intronic
1172071534 20:32260940-32260962 CCAGAGTCTGGGAGCCTCCAGGG + Intergenic
1172676668 20:36677312-36677334 CCTGAGGGTGGGGCCTTACTGGG - Intronic
1172989178 20:39019891-39019913 CCAGAGGCTGGGAGATCCCCTGG - Intronic
1173878788 20:46394956-46394978 GCTGATGCTGGGATCTTCCTAGG - Intronic
1175782429 20:61690978-61691000 CCAGAGGCCCAGCCCTTCCTGGG + Intronic
1175814393 20:61875975-61875997 CCACAGGCTGGCACCTCTCTGGG + Intronic
1176184855 20:63772875-63772897 CCTGAGGCTGGGACCTTGAGTGG - Intronic
1178585308 21:33866379-33866401 CCAAGGGCTGGGCTCTTCCTAGG + Intronic
1178915412 21:36703124-36703146 ACAGAGGCTGGCAGCCTCCTGGG - Intronic
1179155774 21:38849804-38849826 CCAGAGGCCGCCACATTCCTCGG - Intergenic
1180195998 21:46194695-46194717 CAGGGGTCTGGGACCTTCCTTGG - Intronic
1181327456 22:22060903-22060925 CCAGTGGCTGGGTCATTTCTGGG - Intergenic
1181669695 22:24420377-24420399 CCAGAAGCTGGGGCCTGCCAGGG + Intronic
1182441902 22:30369599-30369621 ACAGAGGCTGGGACCCACCTGGG - Exonic
1182453441 22:30434579-30434601 CCAGAAGCCAGGACCCTCCTTGG - Intergenic
1183318099 22:37147986-37148008 CCTGAGGCTGGGCCCGACCTGGG - Intronic
1183878527 22:40805462-40805484 CTAGAGGCTGCCACATTCCTTGG - Intronic
1184613557 22:45622288-45622310 CCTGAGGGTGGGGCCTTACTGGG - Intergenic
1184646707 22:45899119-45899141 CCAGAGGCAGGGGCCTTCCCGGG + Intergenic
1184649038 22:45911262-45911284 TCAGAGGCTGGGTCCTCCCCTGG + Intergenic
1184784086 22:46663441-46663463 CCACTGCCTGGGGCCTTCCTTGG + Intronic
1185291804 22:50031076-50031098 CCAGAGCCTGGGGGCCTCCTGGG - Intronic
950525142 3:13518917-13518939 CCACGGGCTGGGGCCTGCCTGGG - Intergenic
952269012 3:31814384-31814406 CCTGAGGACGTGACCTTCCTTGG + Intronic
952505074 3:33999784-33999806 CCAGAGTCTGGCACCATCCTTGG + Intergenic
953022664 3:39125600-39125622 ACAGAGGCAAGGACCTTACTTGG + Intronic
953069057 3:39502086-39502108 GGAGAGTCTGGGACCCTCCTTGG - Exonic
954650916 3:52162294-52162316 CCTGAAGGTGGGACCTTACTAGG + Intergenic
955204807 3:56886251-56886273 CCAGAGCCTGGGACAATCCCTGG + Intronic
957128999 3:76199283-76199305 CTAAAGGCTGTGACATTCCTGGG - Intronic
958473122 3:94547482-94547504 CCAGAAGTTTGGACCTGCCTGGG - Intergenic
958669993 3:97191468-97191490 CCAGAGGCTGGGAAGGTACTGGG - Intronic
959162775 3:102740441-102740463 CCAGAGGAGGGTTCCTTCCTTGG - Intergenic
959585799 3:108023985-108024007 CTAGAGGCTGCCACGTTCCTTGG - Intergenic
960640057 3:119815493-119815515 CCATAGACTGGGACCTTCCCTGG - Intronic
961474064 3:127136110-127136132 CCAGCGGCTGGGTCCTACCTGGG + Intergenic
962532752 3:136298607-136298629 CCAGAGGCTGGGACAGTCCTGGG + Intronic
965355510 3:167668283-167668305 CCAGAGCCAGGGACTTCCCTGGG - Intergenic
968420462 4:479647-479669 CCAGAGGCTGGGGCCTACACCGG + Intronic
968621195 4:1604184-1604206 ACACAGCCTGGGACCATCCTGGG - Intergenic
968811675 4:2802837-2802859 CCACAGGCTGGGACCCACCAAGG - Intronic
969206114 4:5647286-5647308 GCAGAGGCAGGGGTCTTCCTAGG - Intronic
969231927 4:5838203-5838225 CCCGAGGCAGGGTCCTGCCTGGG + Intronic
969264881 4:6057817-6057839 GCAGAGGTTTGGACCATCCTTGG + Intronic
969471983 4:7394436-7394458 CCAGTGTCGGGGGCCTTCCTGGG + Intronic
969556688 4:7916349-7916371 CCAAAGGCAGGGACCTCTCTGGG + Intronic
969590274 4:8118069-8118091 CCAGAGGTGGTGACTTTCCTGGG - Intronic
970104379 4:12564151-12564173 CCAAAGGCTGGGACCTTCTGGGG + Intergenic
974260375 4:59518339-59518361 GCAGGGGCAGGGGCCTTCCTGGG + Intergenic
974671692 4:65038401-65038423 CCACACGCTGGGGCCTGCCTTGG + Intergenic
974783401 4:66584767-66584789 CAAGAGTTTGAGACCTTCCTGGG + Intergenic
975713265 4:77181374-77181396 CCAGAGTGTGAGACCATCCTGGG - Intronic
978128504 4:105164673-105164695 GCAGAGGCTGGAAGCATCCTGGG - Intronic
984868992 4:184310560-184310582 TCAGGGGCTGTGACCTTCCTAGG + Intergenic
984897702 4:184556543-184556565 CAGGAGTCTGGGACCTGCCTAGG - Intergenic
985041951 4:185899550-185899572 CCAGAGGCTGGGACCCTGACAGG + Intronic
985071113 4:186167868-186167890 AGAGAGGTTGGGACATTCCTAGG - Intronic
985585064 5:727148-727170 CAAGAGGCAGGCAGCTTCCTGGG - Intronic
985598569 5:811463-811485 CAAGAGGCAGGCAGCTTCCTGGG - Intronic
985723069 5:1500923-1500945 ACTGAGGCAGGGACCTCCCTAGG + Intronic
985768318 5:1793477-1793499 CCTGAGGCTGGGCTCTTCCTGGG + Intergenic
986739521 5:10693993-10694015 AGAGAGGCTGGAACCTTGCTTGG + Intronic
990040670 5:51375628-51375650 CAAGATGCAGGGATCTTCCTGGG + Intergenic
993479562 5:88407522-88407544 CCAGAGTTTGGGACCAGCCTGGG + Intergenic
993647079 5:90474813-90474835 CGAGGGGGTGGGGCCTTCCTAGG + Intronic
997029143 5:130103062-130103084 CTAGAGGCTTGGTGCTTCCTGGG + Intronic
997267055 5:132501093-132501115 CCAGTGGCCTGGGCCTTCCTGGG - Intergenic
997376628 5:133402033-133402055 CCAGAGGCTGGCCATTTCCTTGG + Intronic
997427910 5:133816858-133816880 GCAGAGGCTAGGCCCTCCCTGGG - Intergenic
999284811 5:150387992-150388014 TCCGAGGCTCGGGCCTTCCTCGG - Exonic
999433012 5:151540238-151540260 CCAGGGGCAGGGACCATTCTAGG - Intronic
999799442 5:155019621-155019643 CCTGAGGGTGGGGCCTTACTGGG + Intergenic
1000751999 5:165108321-165108343 CCAGACCCTGGGACCTACTTTGG - Intergenic
1002439857 5:179258677-179258699 CCAGACACAGGGACCTTCCCAGG + Intronic
1006104776 6:31710062-31710084 CCACGGGCTGGGACATGCCTTGG + Exonic
1007493491 6:42242953-42242975 CCCAAGGCTGGGACCATCCTTGG + Intronic
1008502638 6:52199149-52199171 CCTGAGGGTGGGATCATCCTTGG - Intergenic
1010017494 6:71121995-71122017 CCAGAGGCTGGTACCCCACTGGG - Intergenic
1010879486 6:81150376-81150398 CCAGAGGCTGGTACCTGCACTGG + Intergenic
1013375495 6:109510074-109510096 CCTGAAGCTGGGGCCTTACTGGG - Intronic
1016309242 6:142715356-142715378 CCGCAGGCTGGGAGCTTCCTGGG + Intergenic
1018143309 6:160861244-160861266 CCAGAGGCTGGGTCCTGGCTAGG + Intergenic
1018815781 6:167329724-167329746 GCAGAGGCTGGGTCCTGGCTAGG - Intronic
1018849877 6:167579185-167579207 CCTGTGGCTGTGACCTTACTTGG - Intergenic
1020093565 7:5355101-5355123 CCAGAAGGAGGGAGCTTCCTGGG - Intronic
1020135603 7:5586288-5586310 CCAGAGGCTGAGGCCTCCCTGGG + Intergenic
1020824353 7:13008864-13008886 CCAGTGGATGGAACTTTCCTAGG + Intergenic
1020841444 7:13222784-13222806 CCAGAGGCTGAGAGGTTCCTGGG - Intergenic
1023469798 7:40504351-40504373 CCAGAGGCTGAGACCAGCCTGGG - Intronic
1024871433 7:53966572-53966594 CCACAGCCTAGGAACTTCCTTGG - Intergenic
1024890504 7:54196098-54196120 TCAGAGGCAGGGATCCTCCTTGG + Intergenic
1025018077 7:55457094-55457116 CCAGAGGCTGGGAAGTTGCAGGG - Intronic
1026359639 7:69591577-69591599 CCTGAGGGTGGGGCCTTACTGGG + Intergenic
1026931901 7:74227619-74227641 CCAGTGCCTGGGTCCTTCCTGGG - Intronic
1027159740 7:75793634-75793656 CCAGAGCCTTGGACATTGCTGGG - Intergenic
1027269764 7:76513024-76513046 TCAGAGGCTGGGACCACCCTGGG - Intronic
1027290390 7:76702943-76702965 GCAGAAGATGGGACATTCCTGGG - Intergenic
1027320475 7:77006919-77006941 TCAGAGGCCGGGACCACCCTGGG - Intergenic
1029437854 7:100572847-100572869 CCAGATGCAGGTACCTCCCTTGG - Exonic
1031258016 7:119481779-119481801 CTTGAGGGTGGGGCCTTCCTAGG - Intergenic
1032057455 7:128695233-128695255 CCAGAGGCTGGGAACCTCTATGG + Intergenic
1032521303 7:132547553-132547575 CAAGAGGCTGGGAGCTGTCTGGG + Intronic
1032996270 7:137450114-137450136 CCAGAGGCTGGGGCATTTCGGGG + Intronic
1035185792 7:157125195-157125217 CCAGAGGCTTCCTCCTTCCTCGG - Intergenic
1035332177 7:158103494-158103516 CCAGAGAGTGGGCCCTGCCTCGG - Intronic
1035381732 7:158445118-158445140 CCTGAGGCTGGGACATGCCTGGG - Intronic
1037689021 8:21167405-21167427 CCAGTGGAGGGGACTTTCCTGGG - Intergenic
1039387821 8:37152062-37152084 CCAGAGGCTGGGGCCTCCACAGG - Intergenic
1039798034 8:40932105-40932127 CCAGAGATTGAGACCATCCTGGG + Intergenic
1041186787 8:55309026-55309048 CCAGAGGCTGCTGCATTCCTTGG - Intronic
1041527389 8:58822607-58822629 ACAGAGGCTGAGACCTTCAGAGG - Intronic
1041657796 8:60371139-60371161 CCAGAGGCTGCCCCATTCCTTGG - Intergenic
1041798940 8:61776963-61776985 CCTGAGGCAGGCATCTTCCTCGG + Intergenic
1043237366 8:77884911-77884933 AAAGAGGCTGGGACCTTCCCTGG + Intergenic
1043497378 8:80817279-80817301 CCAGCAGCTGGGCCCTTCCTTGG - Intronic
1043962739 8:86435906-86435928 CCAGAGGTTGAGACCAACCTGGG - Intronic
1044626080 8:94235764-94235786 CCCGAGGCTGGGGCCTTGATGGG - Intergenic
1045327330 8:101126792-101126814 CCAGAGGCCGCGGCCTTCCTTGG + Intergenic
1047644433 8:126855011-126855033 GCAGAGGCTGAGTCCTGCCTTGG + Intergenic
1048016194 8:130499775-130499797 GCAGGGGCTGAGCCCTTCCTAGG + Intergenic
1048256772 8:132910849-132910871 CCAAAGCCTGGCACCATCCTTGG + Intronic
1048295963 8:133213283-133213305 CCAGAGGCTGGGTCCTTCCTGGG + Intronic
1048564411 8:135580189-135580211 TCAGAGGCTGGGACCAGTCTGGG - Intronic
1048586258 8:135776920-135776942 CCAGAGGCTGAGCCTTCCCTTGG - Intergenic
1049058082 8:140254605-140254627 CTGGAAGCTGGGCCCTTCCTGGG - Intronic
1049157950 8:141078409-141078431 CCTGTGGATGGGACCTTACTGGG - Intergenic
1049196849 8:141320507-141320529 CCAGAGGATGGCACCCACCTGGG - Intergenic
1049641310 8:143717275-143717297 CCAGAGGCTGGGACCAGGGTGGG + Intronic
1050974656 9:11922242-11922264 CCAGAGGCTGGGAATTTAGTTGG - Intergenic
1052062560 9:23978753-23978775 CCAGAAGTTGGGACCAACCTGGG - Intergenic
1053181941 9:35980244-35980266 CCAGAGTGTGGGAGGTTCCTAGG + Intergenic
1056986087 9:91364586-91364608 CCAGAAGCTGGGGCCTCACTGGG - Intergenic
1057199112 9:93131023-93131045 CCATATGCTAGGACCTGCCTGGG + Intronic
1058469658 9:105264373-105264395 CCAGAGTTTGAGACCCTCCTGGG - Intronic
1058901143 9:109443417-109443439 CCAGAGTCTGAGACCAGCCTGGG - Intronic
1059565478 9:115379859-115379881 CCTGAGAATGGGACCTTACTGGG - Intronic
1060125601 9:121041621-121041643 CCAGAGGCTGGGACCTTCCTCGG - Intronic
1060506180 9:124199953-124199975 CAAGAGTCTGGGACCAGCCTGGG - Intergenic
1060530814 9:124346241-124346263 TCAGAGCCTGGCACCATCCTTGG - Intronic
1060738361 9:126080906-126080928 TCAGAGGCTGGCACCAACCTGGG - Intergenic
1060796575 9:126516119-126516141 CCCCAGGCTGGGGCCTTCCAAGG + Intergenic
1060882156 9:127124851-127124873 CCAGAGGGTGGGAAAGTCCTAGG - Intronic
1061140302 9:128762252-128762274 CCAGAAGCTGGGACAATGCTGGG - Intronic
1061337413 9:129949650-129949672 CAAGAGTCTGAGACCTGCCTGGG + Intronic
1061757672 9:132826739-132826761 CCAGTGTCTGGGACATGCCTGGG - Intronic
1062044814 9:134420087-134420109 CTAGTGGCTGGGAAGTTCCTGGG + Intronic
1062254356 9:135614129-135614151 CCAGAGGCGGTGTCATTCCTGGG + Intergenic
1062270434 9:135705818-135705840 GCAGAGGCCGCGAGCTTCCTGGG + Intronic
1185550110 X:976180-976202 CTAGAGTTTGAGACCTTCCTGGG + Intergenic
1185586115 X:1243114-1243136 CCACATGCTGGGTCCTTCCTGGG - Intergenic
1186472455 X:9832215-9832237 CCAGAGGCAGGGAGCTCCTTAGG + Intronic
1186725426 X:12353112-12353134 CCAGAGACAGGGACCTTTCCTGG + Intronic
1187248575 X:17575935-17575957 CCAGAGAGTGGTACCCTCCTTGG + Intronic
1188301790 X:28513739-28513761 CCAGAGGCTGGGACAGTTTTTGG + Intergenic
1191797336 X:65034995-65035017 CCAGCGGCCCGGACCCTCCTGGG - Intergenic
1192268165 X:69554893-69554915 CTAGAGGCTGTGACCTGCATGGG + Intergenic
1195328251 X:103775491-103775513 GCAGAGACTAGTACCTTCCTGGG - Intronic
1199596422 X:149509661-149509683 CCAGGGGCTAGTACCTTCGTGGG + Intronic
1199874868 X:151921526-151921548 GCAGAGCCTGGGCCCTGCCTTGG - Intronic
1199967223 X:152830654-152830676 CCAGCGGCTGAGCCCTTCCCAGG - Intronic
1199990426 X:152984671-152984693 CCTGAGGGTGGGACCCACCTCGG + Intergenic
1200033516 X:153314145-153314167 CCTGAGGGTGGGACCCACCTCGG + Intergenic
1200208503 X:154334726-154334748 CCAGAGCCTGAGCCCTTTCTCGG - Intergenic
1200738436 Y:6827278-6827300 CCAGAGCCTGGTAGCTTCATAGG - Intergenic