ID: 1060125603

View in Genome Browser
Species Human (GRCh38)
Location 9:121041632-121041654
Sequence CAGTGTAATATCCAGAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060125603_1060125607 12 Left 1060125603 9:121041632-121041654 CCCAGCCTCTGGATATTACACTG 0: 1
1: 0
2: 0
3: 4
4: 126
Right 1060125607 9:121041667-121041689 AGACTGATGACCCTTAGTTGTGG No data
1060125603_1060125608 13 Left 1060125603 9:121041632-121041654 CCCAGCCTCTGGATATTACACTG 0: 1
1: 0
2: 0
3: 4
4: 126
Right 1060125608 9:121041668-121041690 GACTGATGACCCTTAGTTGTGGG No data
1060125603_1060125611 26 Left 1060125603 9:121041632-121041654 CCCAGCCTCTGGATATTACACTG 0: 1
1: 0
2: 0
3: 4
4: 126
Right 1060125611 9:121041681-121041703 TAGTTGTGGGACGTGTCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060125603 Original CRISPR CAGTGTAATATCCAGAGGCT GGG (reversed) Intronic
903200800 1:21736841-21736863 CCGTGTATTTTGCAGAGGCTTGG - Intronic
904890128 1:33773569-33773591 CAGAGGAAGCTCCAGAGGCTTGG - Intronic
905576724 1:39050390-39050412 TAAAGTAAGATCCAGAGGCTGGG + Intergenic
906658527 1:47566034-47566056 CAGGGCAGTGTCCAGAGGCTGGG + Intergenic
908522106 1:64954285-64954307 CTTTGTAATAGCCAGAGACTTGG - Intronic
908538820 1:65103573-65103595 AAGTGTGCTATCCAGAGGTTGGG - Intergenic
909069048 1:70971529-70971551 CAATCTAATATTCAGAGGCATGG + Intronic
915408367 1:155680137-155680159 CACTGTATTCTCCAGAGCCTGGG + Intronic
918384156 1:183988194-183988216 CAGTCTAATATCAAGAGAATTGG + Intronic
919218514 1:194593233-194593255 CAGTGAAATATCCAAAGCTTTGG + Intergenic
919749519 1:201028257-201028279 CAGTGTCAGATCCAGAGGGCGGG + Intergenic
920560726 1:206936638-206936660 CAGTGAAACATTTAGAGGCTGGG + Intronic
922385217 1:225074872-225074894 CAGGATAACATCCAGTGGCTTGG - Intronic
923900689 1:238323044-238323066 CTGTGTGTTAGCCAGAGGCTGGG + Intergenic
1063626601 10:7696225-7696247 CAGTGTAATTTCCAAATGATGGG + Intergenic
1067364333 10:45611032-45611054 CAGTGTAATTACAAGAGGATGGG - Intergenic
1070589077 10:77788814-77788836 CAGTGGGCTAACCAGAGGCTTGG - Intergenic
1076465141 10:130675281-130675303 CTGTTTAATATCCAAAAGCTAGG - Intergenic
1077959724 11:7062481-7062503 AACTGTAACATTCAGAGGCTCGG + Exonic
1078078687 11:8186240-8186262 CTGTGTAATTTCCAGGGGATTGG + Intergenic
1078750704 11:14159865-14159887 AAGGATAATTTCCAGAGGCTGGG + Intronic
1079995244 11:27288724-27288746 AAGTGAAATTTCCAGAGGCAGGG - Intergenic
1080791610 11:35526561-35526583 AATTGTAAAATACAGAGGCTAGG - Intronic
1087116115 11:94526653-94526675 GAGTTTATTATCCAGAGGCTGGG + Intergenic
1089762669 11:120739835-120739857 CTGTCTAATATCCAGAGGGCGGG + Intronic
1090222191 11:125037402-125037424 CAATGAAATAACCTGAGGCTAGG - Intronic
1094711740 12:32970890-32970912 CAATGTAATATCCCAGGGCTGGG - Intergenic
1097039231 12:56144634-56144656 TAATGTAAGATCCAGTGGCTTGG - Intronic
1097325232 12:58269076-58269098 CAATGTCATAGCCAGAGGCCAGG - Intergenic
1098199713 12:68041740-68041762 CAGTGTAATATGAAGAGATTTGG - Intergenic
1100600404 12:96107776-96107798 AAGTGGAATAGCCAGTGGCTGGG - Intergenic
1107179612 13:37443552-37443574 AAGTGTAATACCCAGACACTAGG - Intergenic
1109078339 13:57865712-57865734 CAGATTAATATCCAAAGGCTGGG + Intergenic
1111355259 13:87091839-87091861 CAGTGTTGGATCAAGAGGCTGGG + Intergenic
1115174143 14:30543168-30543190 GAGTGTACTGTCCAGAGCCTTGG - Intergenic
1115931256 14:38498044-38498066 AAGTCTAATCTCCAGAGACTTGG - Intergenic
1121175022 14:91884639-91884661 AAGTGTAGGATCTAGAGGCTGGG - Intronic
1125578668 15:40771052-40771074 GACTGGAAGATCCAGAGGCTGGG + Exonic
1129020470 15:72513403-72513425 AACTGTAATATAAAGAGGCTAGG - Intronic
1129952894 15:79607512-79607534 CAGTGTAGTTTCCTTAGGCTGGG - Intergenic
1130375392 15:83324444-83324466 CAGTGAATTCTGCAGAGGCTGGG - Intergenic
1131600957 15:93848270-93848292 CAGAGGAATATACAGAGGCCAGG - Intergenic
1135704607 16:24663985-24664007 CAGGGTTATCTCAAGAGGCTTGG - Intergenic
1136038018 16:27555373-27555395 CAGTGTAATGTCCTTAGGTTTGG + Intronic
1139839918 16:69870045-69870067 CAGTTTAATGTCAAGAGCCTAGG - Intronic
1140199301 16:72881658-72881680 AAGTGTGAACTCCAGAGGCTAGG + Intronic
1140952268 16:79830234-79830256 AATTTTAATATCCAGATGCTGGG - Intergenic
1143516461 17:7421533-7421555 CAGTGCTGGATCCAGAGGCTAGG - Exonic
1145777902 17:27542156-27542178 CAGTGAAAATTTCAGAGGCTAGG - Intronic
1146000936 17:29129932-29129954 GAGTGTAGGATCCAGTGGCTAGG - Intronic
1151862504 17:76775458-76775480 CAGTGAAATATCCAGACATTAGG + Intronic
1152473028 17:80500706-80500728 CAGTGCAAAATGCAGAGGCATGG + Intergenic
1153035936 18:762371-762393 CAGTGTAATATCCAACAGGTAGG - Intronic
1153454848 18:5270024-5270046 CAGAGTAATTTCAAGAGGATTGG - Intergenic
1163890429 19:20007843-20007865 CAGTGCAAGATGCAGAGCCTCGG - Intronic
1167040937 19:47021999-47022021 CAGTTTAATAAACTGAGGCTTGG - Intronic
926794288 2:16606238-16606260 CAGTGTCATAACCAGAGCCCTGG + Intronic
927975242 2:27333655-27333677 CATTATAATATCCAGCAGCTAGG + Exonic
931852436 2:66265386-66265408 CACTGGAGTCTCCAGAGGCTGGG - Intergenic
932170588 2:69551982-69552004 CTGTGTAATATGCTGAGGTTTGG - Intronic
934032492 2:88060962-88060984 CAGTGTATCATCAAAAGGCTAGG - Intergenic
935542487 2:104365716-104365738 CAATGCAATATCTAGAAGCTTGG - Intergenic
936658787 2:114518894-114518916 CAGTTTATTACTCAGAGGCTGGG + Intronic
941184523 2:162305179-162305201 AAGTGTAATATCCACATTCTGGG + Intronic
942634517 2:177988613-177988635 CAGTGTAAAATGAAAAGGCTGGG - Intronic
944090487 2:195904424-195904446 CAGTGTAACAGACAGAGGCAGGG + Intronic
945276050 2:207988781-207988803 CAGAGCAATAGCCAGAGGCCAGG - Intronic
948213550 2:236212334-236212356 CAGTGTAATTTCTACAGCCTTGG + Intronic
948233793 2:236371437-236371459 CAGTGTGCTTTCCAGAGGCAGGG + Intronic
1169611233 20:7382290-7382312 CAGGGAAATAACCATAGGCTGGG + Intergenic
1173928313 20:46797575-46797597 CAGAGTATGACCCAGAGGCTTGG + Intergenic
1178472329 21:32904659-32904681 AAGTCTAAAATCCAGAGGGTAGG + Intergenic
1181173607 22:21023701-21023723 TAGTGGAATATCTAGAGGCCTGG - Intronic
1184238138 22:43197438-43197460 CACTGTATTGTCCAGACGCTTGG - Exonic
950367022 3:12494165-12494187 CACTGTAATATCCAAAGACTGGG + Intronic
956432347 3:69199891-69199913 CATTGTACTATCCTGAGCCTTGG + Intronic
957516648 3:81262977-81262999 CATTGTAAAATCAAGAGGTTGGG - Intergenic
958563229 3:95775687-95775709 CAGATTAACATCCAAAGGCTGGG + Intergenic
958671251 3:97208036-97208058 CTGTGTAATCACCAGAGACTAGG - Intronic
959544906 3:107584574-107584596 CAATGGAATATCAAGAGGATTGG + Intronic
963231088 3:142909439-142909461 CACTGTGAGTTCCAGAGGCTGGG + Intergenic
963890355 3:150629198-150629220 TACTGTAATCTCCAGATGCTAGG + Exonic
966158192 3:176940883-176940905 CAGGGTTATTACCAGAGGCTGGG + Intergenic
969856752 4:10006166-10006188 CAATTTTATGTCCAGAGGCTTGG - Intronic
970238509 4:13983289-13983311 GAGTGTTATTCCCAGAGGCTGGG + Intergenic
971036317 4:22696654-22696676 CAGTGAAATAGCCAGAGGAGAGG - Intergenic
972502057 4:39687432-39687454 CAGCTTGATATCCAGAGGCAGGG + Intergenic
974078912 4:57193297-57193319 AAGTGTAACATCCAGAGCCCAGG + Intergenic
974441094 4:61918539-61918561 CACTGTAATATGAAGAGGTTGGG + Intronic
974910761 4:68116907-68116929 AAGTCTAATATCTAGAAGCTTGG - Intronic
981758354 4:148166471-148166493 CAGTGTAAATTCCAGAGCTTTGG + Intronic
985384080 4:189426779-189426801 CAGTGAAAAATCGAGAGGGTTGG - Intergenic
985856936 5:2435552-2435574 CAGTGAAGTATCCAGGGGCCAGG - Intergenic
988152323 5:27400206-27400228 GAGAGTAGTTTCCAGAGGCTGGG + Intergenic
988641718 5:33048216-33048238 GACTGTGATAACCAGAGGCTGGG + Intergenic
989238513 5:39176939-39176961 CAGCCTAATTTCCAGAGACTGGG + Intronic
989301589 5:39901323-39901345 CAGTGAACTATCCAGAGACAGGG - Intergenic
991341202 5:65611827-65611849 CAGTGCAATATACAGAGGCAAGG + Exonic
991519390 5:67478911-67478933 AAGTGTATTTTCCAGAGGTTTGG - Intergenic
991776773 5:70092845-70092867 AAGTTTAATATACAGATGCTCGG - Intergenic
991856060 5:70968290-70968312 AAGTTTAATATACAGATGCTCGG - Intergenic
991870074 5:71101063-71101085 AAGTTTAATATACAGATGCTCGG - Intergenic
994681410 5:102892164-102892186 CAATGCAATTTCCAAAGGCTAGG - Intronic
995582928 5:113619636-113619658 CAGTGAAACGTCCAGAGGGTCGG + Intergenic
1001200300 5:169709933-169709955 TAGTGTCATATCCTGGGGCTAGG + Intronic
1003241864 6:4352157-4352179 CAGCGTTATATCGAGAGGCCTGG + Intergenic
1010564076 6:77387004-77387026 CAGTGTTATATCAAAATGCTTGG + Intergenic
1010657087 6:78524351-78524373 CAGTGAAATATCTACAGGATTGG + Intergenic
1010816849 6:80368173-80368195 CAGTTGGATATTCAGAGGCTGGG - Intergenic
1015792607 6:136979374-136979396 CAGTGCACTCACCAGAGGCTTGG - Intergenic
1017440949 6:154463814-154463836 CAGTGTAAAATGCAGGAGCTGGG + Intronic
1021352367 7:19610850-19610872 CAGCCAAATATCCAGAGACTGGG + Intergenic
1024297664 7:47858753-47858775 CGGTCTCATATCCAGAGTCTGGG - Exonic
1026511924 7:71034499-71034521 CTTTGTAGTATCCAGAGGATGGG - Intergenic
1026908531 7:74078646-74078668 CAAAGTAGTAGCCAGAGGCTAGG + Intergenic
1031161466 7:118173735-118173757 CAGAATAATATGCAGAGGTTAGG + Intergenic
1032183457 7:129702085-129702107 CAGTCTCCTATCCAGAGGCATGG - Intronic
1033974470 7:147082935-147082957 CACTGCAATTTCCAGAGGCAGGG + Intronic
1047057797 8:121186246-121186268 AAGGGTAGTTTCCAGAGGCTGGG + Intergenic
1048086785 8:131189919-131189941 CACTGATATATCCAGAGCCTGGG + Intergenic
1050499469 9:6280726-6280748 TACTGTAATCTCCAGATGCTAGG + Intergenic
1053668615 9:40337444-40337466 CAGTTTAATATCTAAATGCTAGG + Intergenic
1054379755 9:64477496-64477518 CAGTTTAATATCTAAATGCTAGG + Intergenic
1054515996 9:66038850-66038872 CAGTTTAATATCTAAATGCTAGG - Intergenic
1060125603 9:121041632-121041654 CAGTGTAATATCCAGAGGCTGGG - Intronic
1060814585 9:126627900-126627922 CAGTGTTAAAGCCAGAGTCTGGG - Intronic
1188188602 X:27146459-27146481 CAGTGTAATAACCAGAGTGATGG - Intergenic
1189871471 X:45387422-45387444 AATTGTAATTTCCATAGGCTGGG - Intergenic
1192824245 X:74678478-74678500 CAATGTAATATCCAGAAGGAAGG - Intergenic
1194617551 X:96124871-96124893 CAGTGTAAGCACCAGAGGCCTGG - Intergenic
1195596094 X:106691538-106691560 CAGGGTAGTTACCAGAGGCTGGG - Intergenic