ID: 1060125604

View in Genome Browser
Species Human (GRCh38)
Location 9:121041633-121041655
Sequence GCAGTGTAATATCCAGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060125604_1060125611 25 Left 1060125604 9:121041633-121041655 CCAGCCTCTGGATATTACACTGC 0: 1
1: 0
2: 0
3: 4
4: 134
Right 1060125611 9:121041681-121041703 TAGTTGTGGGACGTGTCAACAGG No data
1060125604_1060125607 11 Left 1060125604 9:121041633-121041655 CCAGCCTCTGGATATTACACTGC 0: 1
1: 0
2: 0
3: 4
4: 134
Right 1060125607 9:121041667-121041689 AGACTGATGACCCTTAGTTGTGG No data
1060125604_1060125608 12 Left 1060125604 9:121041633-121041655 CCAGCCTCTGGATATTACACTGC 0: 1
1: 0
2: 0
3: 4
4: 134
Right 1060125608 9:121041668-121041690 GACTGATGACCCTTAGTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060125604 Original CRISPR GCAGTGTAATATCCAGAGGC TGG (reversed) Intronic
902409184 1:16202706-16202728 GCAGTGCCCTATCCAGAAGCAGG - Intronic
904245305 1:29183342-29183364 GCAGTGTAATAACAAAAGGTTGG - Intergenic
907985134 1:59523102-59523124 GCAGTGTCAGAACCAGTGGCTGG - Intronic
911708428 1:101041442-101041464 GCTGTGTAACAGGCAGAGGCTGG - Intergenic
913978042 1:143481051-143481073 TCAGTGAAATATCCACAGGTGGG - Intergenic
916064094 1:161122086-161122108 ACAGTGTAAGCTCCAGAGGTGGG + Exonic
916933608 1:169605079-169605101 GCTGTGAAACACCCAGAGGCAGG + Intronic
919270193 1:195331595-195331617 GAAGTCTAAGATCAAGAGGCTGG - Intergenic
919749518 1:201028256-201028278 TCAGTGTCAGATCCAGAGGGCGG + Intergenic
922960717 1:229643639-229643661 GCAGTGTATTCTCCAGGGACTGG + Exonic
923906438 1:238390495-238390517 GCAGTGTCAAAACCAGAGTCAGG - Intergenic
1063435277 10:6024524-6024546 GCACTTGAATACCCAGAGGCCGG - Intronic
1063916113 10:10884277-10884299 GCTGTGTATTTTCTAGAGGCTGG + Intergenic
1066997227 10:42575417-42575439 GTAGTGCAAAATCCATAGGCAGG - Intronic
1067364334 10:45611033-45611055 GCAGTGTAATTACAAGAGGATGG - Intergenic
1070680473 10:78445584-78445606 GAGTTCTAATATCCAGAGGCAGG - Intergenic
1073622714 10:105065556-105065578 TCAGTGTAAGTTCTAGAGGCTGG + Intronic
1074163299 10:110852313-110852335 GGACTTTACTATCCAGAGGCAGG + Intergenic
1076564015 10:131386153-131386175 GCAGAGGAATAACCAGAGGGAGG + Intergenic
1078750703 11:14159864-14159886 GAAGGATAATTTCCAGAGGCTGG + Intronic
1079995245 11:27288725-27288747 TAAGTGAAATTTCCAGAGGCAGG - Intergenic
1082201054 11:49368018-49368040 GTAGTTTAATTTGCAGAGGCAGG + Intergenic
1085234824 11:75006278-75006300 ACAGTGCAAGATCCAGGGGCGGG - Exonic
1086906227 11:92421041-92421063 ATAGTGTAATATCAACAGGCAGG - Intronic
1087116114 11:94526652-94526674 AGAGTTTATTATCCAGAGGCTGG + Intergenic
1088599622 11:111462933-111462955 GCAATGTAATATTCAGGGGTAGG + Intergenic
1089762668 11:120739834-120739856 TCTGTCTAATATCCAGAGGGCGG + Intronic
1090433008 11:126662471-126662493 GAAGTGCAAGATCTAGAGGCTGG + Intronic
1094040576 12:26116987-26117009 GAAGTCCAATACCCAGAGGCAGG + Intergenic
1094305581 12:29015950-29015972 GGAGTCTAATATCAAGAAGCTGG + Intergenic
1096506201 12:52095206-52095228 GGATTGTAATATCCAGCGGTGGG - Intergenic
1097300495 12:58013450-58013472 GCAGTGTAATTCCCAGATCCAGG + Intergenic
1100687621 12:97004016-97004038 GAAGTGCAAGATCCAGATGCTGG + Intergenic
1102616173 12:114156255-114156277 CCAGTGTAGTATCCAGGAGCAGG - Intergenic
1107638197 13:42414506-42414528 GCAGTCTGATGTCCAAAGGCAGG + Intergenic
1107843946 13:44491255-44491277 GAAGATTAGTATCCAGAGGCCGG + Intronic
1108099693 13:46941760-46941782 GAAGTGTCATTACCAGAGGCAGG + Intergenic
1108294504 13:48999889-48999911 GAAGTTTAAGATCCAGATGCTGG - Intronic
1109078338 13:57865711-57865733 GCAGATTAATATCCAAAGGCTGG + Intergenic
1109443780 13:62406930-62406952 GCAGGCAAATATCCACAGGCCGG + Intergenic
1110969545 13:81743788-81743810 GCAGTCTAATATTCAAGGGCAGG + Intergenic
1113089298 13:106600225-106600247 GCAGTGTGATACACAGATGCTGG - Intergenic
1114896682 14:26999657-26999679 GCAGGGGAATCTCCACAGGCAGG + Intergenic
1115227488 14:31119126-31119148 ACAGTGTAATCACAAGAGGCAGG - Intronic
1121164366 14:91777699-91777721 GAAGTCTAATATCAAGATGCCGG + Intronic
1128145264 15:65329341-65329363 GCAGTGTCAGAGCCTGAGGCGGG + Intronic
1130024640 15:80260723-80260745 GCTGTGTCATCTGCAGAGGCAGG - Intergenic
1136491891 16:30613979-30614001 GCAGTGAGATATTCAGAGGAAGG + Intronic
1143368068 17:6421328-6421350 GCTGTGTTCTTTCCAGAGGCCGG - Intronic
1144901952 17:18602714-18602736 GCATTGTAATATCAAGAAGTTGG - Intergenic
1144914778 17:18715404-18715426 GCATTTTAATATCAAGAGCCAGG + Intronic
1145130552 17:20343355-20343377 GCATTGTAATATCAAGAAGTTGG + Intergenic
1145838645 17:27974954-27974976 GCATGCTAATACCCAGAGGCAGG + Intergenic
1151566908 17:74903769-74903791 GCAGTGGTGTATCCAGAGGAGGG + Intergenic
1153691770 18:7601282-7601304 GCAGAGAAATATCCAGAGCTAGG - Intronic
1157584454 18:48792235-48792257 GCAGTGAAAGGCCCAGAGGCAGG + Intronic
1157609498 18:48947655-48947677 GCACTGTGATGTCCAGAGGATGG + Intronic
1159259516 18:65994157-65994179 GCAGTGGTATAACCAGAAGCAGG - Intergenic
1161572850 19:5039946-5039968 GCAGTACAATATCCAGAAGAAGG + Exonic
927282310 2:21319971-21319993 GCACCTCAATATCCAGAGGCTGG - Intergenic
930231888 2:48851660-48851682 GAAGTGTAATATCAAGGTGCTGG + Intergenic
934182747 2:89642059-89642081 TCAGTGAAATATCCACAGGTGGG - Intergenic
934293039 2:91716248-91716270 TCAGTGAAATATCCACAGGTGGG - Intergenic
935445315 2:103150298-103150320 GCAGTGCAATAGTCAGAGGTAGG + Intergenic
938155355 2:128933830-128933852 GAAGGGTAGTTTCCAGAGGCTGG - Intergenic
943979720 2:194532823-194532845 GCACAGGAATATCCAGTGGCTGG + Intergenic
944090486 2:195904423-195904445 CCAGTGTAACAGACAGAGGCAGG + Intronic
944600736 2:201300469-201300491 GAAGTGGAATCTACAGAGGCAGG - Intronic
948233792 2:236371436-236371458 GCAGTGTGCTTTCCAGAGGCAGG + Intronic
1176687667 21:9865671-9865693 GCAGATTAATATCCAAAGACTGG - Intergenic
1177734680 21:25073751-25073773 ACTGTGTAATATGCAGAAGCTGG - Intergenic
1178679435 21:34660135-34660157 GCAGGGCAATCTCCAGGGGCAGG - Intergenic
1179989293 21:44938663-44938685 GCTGTGAAAACTCCAGAGGCTGG - Intronic
1180065708 21:45411181-45411203 GCAGGGTGTTATCCAGGGGCAGG + Intronic
1182092031 22:27602522-27602544 GAAGTGAGATATCCAGAGGTGGG + Intergenic
950367021 3:12494164-12494186 ACACTGTAATATCCAAAGACTGG + Intronic
958563228 3:95775686-95775708 GCAGATTAACATCCAAAGGCTGG + Intergenic
960474067 3:118102385-118102407 GAAGGGTAATTACCAGAGGCTGG - Intergenic
961491251 3:127258037-127258059 GCTGAATAATACCCAGAGGCTGG - Intergenic
962086456 3:132196736-132196758 GCAGAGCAACACCCAGAGGCTGG - Intronic
963231087 3:142909438-142909460 GCACTGTGAGTTCCAGAGGCTGG + Intergenic
967380406 3:188851567-188851589 GCAGTGTAATTTCATGAAGCAGG - Intronic
967961684 3:194930524-194930546 GCAGAAGAACATCCAGAGGCAGG + Intergenic
970628371 4:17914878-17914900 GCAGTGTTATATCAGGAGGCAGG - Intronic
972502056 4:39687431-39687453 TCAGCTTGATATCCAGAGGCAGG + Intergenic
976430475 4:84958163-84958185 GCAGTGGAAAAGGCAGAGGCTGG + Intronic
977305511 4:95318808-95318830 GCAGTTTAATAGGCAGAGACAGG + Intronic
977947309 4:102928526-102928548 GCTGTGTAATGTGCAGAGGGTGG - Intronic
980351021 4:131683487-131683509 GCAGATTAATATCCAAAGACTGG - Intergenic
980455403 4:133034276-133034298 ACAGTGTAGTTACCAGAGGCTGG + Intergenic
981393380 4:144217831-144217853 GCTGGGTAATAGGCAGAGGCTGG - Intergenic
982537927 4:156629662-156629684 GTATTGTAGTATCCAGAGGTTGG - Intergenic
983159261 4:164390620-164390642 GAAGTGTAAAATCAAGATGCTGG - Intergenic
985794798 5:1953950-1953972 GCAGTGGAGTCTACAGAGGCAGG - Intergenic
988170404 5:27647222-27647244 GCAGTATAATAGCCTCAGGCAGG - Intergenic
988641717 5:33048215-33048237 GGACTGTGATAACCAGAGGCTGG + Intergenic
989301590 5:39901324-39901346 TCAGTGAACTATCCAGAGACAGG - Intergenic
989801475 5:45546420-45546442 ACAGTGTAATATCCAAATTCTGG + Intronic
992658216 5:78931501-78931523 GCAGTGAAATGGCCAGAGACAGG - Intronic
993304210 5:86254408-86254430 GAAGTCTAATATCAAGATGCCGG - Intergenic
996165038 5:120213098-120213120 GCAGTGTGATATCCTGAGGAAGG + Intergenic
998199264 5:140107143-140107165 GCAGTGTAATATGTTGAAGCCGG - Intergenic
1000034467 5:157434155-157434177 GGAGTGTAATATTCTGAGACAGG + Intronic
1001584458 5:172823958-172823980 GCAGTGTAAAGGCCAGGGGCAGG + Intergenic
1003360282 6:5419442-5419464 GCAGGGTCATATTCAGAGGAAGG + Intronic
1007787758 6:44291004-44291026 GCTGTGTCATGCCCAGAGGCAGG - Intronic
1010816850 6:80368174-80368196 GCAGTTGGATATTCAGAGGCTGG - Intergenic
1014880569 6:126719069-126719091 GTTGTGTGATATTCAGAGGCTGG + Intergenic
1017345831 6:153379695-153379717 GCTCATTAATATCCAGAGGCAGG + Intergenic
1017440948 6:154463813-154463835 GCAGTGTAAAATGCAGGAGCTGG + Intronic
1021836961 7:24686449-24686471 GCAGGGCAAAATCCAGAGGAAGG - Intronic
1024866852 7:53913173-53913195 GCTGTGGCATATCCAGAGGATGG - Intergenic
1024910905 7:54445656-54445678 TCAGTGTACTATGCAGAAGCAGG - Intergenic
1026511925 7:71034500-71034522 GCTTTGTAGTATCCAGAGGATGG - Intergenic
1029187115 7:98747115-98747137 GGATTGTAAGATCCACAGGCTGG - Intergenic
1030737373 7:113065614-113065636 GCAGTGAAGAATCCAGAGGGAGG - Intergenic
1033974469 7:147082934-147082956 ACACTGCAATTTCCAGAGGCAGG + Intronic
1039417695 8:37409676-37409698 GGAGTGTGATGTCCAAAGGCAGG - Intergenic
1039950468 8:42167779-42167801 GCAGTTTAAGATCCAGCAGCTGG + Exonic
1047057796 8:121186245-121186267 GAAGGGTAGTTTCCAGAGGCTGG + Intergenic
1047825760 8:128572943-128572965 CAAGTGCAATATCCTGAGGCAGG + Intergenic
1048195622 8:132329670-132329692 GCATTGTATTACCAAGAGGCTGG + Intronic
1052900198 9:33787037-33787059 GCAGTGTTCTATCCACAGTCAGG + Intronic
1053781689 9:41616228-41616250 GCAGATTAATATCCAAAGACTGG + Intergenic
1054169637 9:61826382-61826404 GCAGATTAATATCCAAAGACTGG + Intergenic
1054667901 9:67754433-67754455 GCAGATTAATATCCAAAGACTGG - Intergenic
1056288286 9:85113777-85113799 GCACTATAAGATCCAGAGTCAGG + Intergenic
1058325311 9:103689105-103689127 GCAGTGCAAAAACCAGAAGCAGG - Intergenic
1059582304 9:115565282-115565304 ACTGGGTAATATGCAGAGGCTGG - Intergenic
1060125604 9:121041633-121041655 GCAGTGTAATATCCAGAGGCTGG - Intronic
1186817257 X:13250049-13250071 GCACTGTGGTATCCACAGGCTGG + Intergenic
1186883045 X:13885581-13885603 TCAGTGAAATCTTCAGAGGCTGG + Intronic
1189871472 X:45387423-45387445 GAATTGTAATTTCCATAGGCTGG - Intergenic
1191013353 X:55784466-55784488 GGAGTCTAATGTCCAAAGGCAGG + Intergenic
1191586268 X:62829788-62829810 GCAGGGGAAGAACCAGAGGCAGG + Intergenic
1196655880 X:118216647-118216669 GCAGTGTATGCTACAGAGGCGGG - Intergenic
1198410356 X:136360877-136360899 GCAGTTTTATATCCAAAGACAGG - Intronic
1199915591 X:152336738-152336760 GCATTATAATTTCCAGAAGCTGG + Intronic
1201552605 Y:15234512-15234534 GCAGTGTAGGAGGCAGAGGCAGG - Intergenic