ID: 1060125608

View in Genome Browser
Species Human (GRCh38)
Location 9:121041668-121041690
Sequence GACTGATGACCCTTAGTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060125601_1060125608 24 Left 1060125601 9:121041621-121041643 CCGAGGAAGGTCCCAGCCTCTGG 0: 1
1: 1
2: 3
3: 42
4: 353
Right 1060125608 9:121041668-121041690 GACTGATGACCCTTAGTTGTGGG No data
1060125604_1060125608 12 Left 1060125604 9:121041633-121041655 CCAGCCTCTGGATATTACACTGC 0: 1
1: 0
2: 0
3: 4
4: 134
Right 1060125608 9:121041668-121041690 GACTGATGACCCTTAGTTGTGGG No data
1060125605_1060125608 8 Left 1060125605 9:121041637-121041659 CCTCTGGATATTACACTGCTTAC 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1060125608 9:121041668-121041690 GACTGATGACCCTTAGTTGTGGG No data
1060125603_1060125608 13 Left 1060125603 9:121041632-121041654 CCCAGCCTCTGGATATTACACTG 0: 1
1: 0
2: 0
3: 4
4: 126
Right 1060125608 9:121041668-121041690 GACTGATGACCCTTAGTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060125608 Original CRISPR GACTGATGACCCTTAGTTGT GGG Intronic
No off target data available for this crispr