ID: 1060126604

View in Genome Browser
Species Human (GRCh38)
Location 9:121053679-121053701
Sequence GCTGTGCAGCCTGTGGTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060126604_1060126612 27 Left 1060126604 9:121053679-121053701 CCTCCAACCACAGGCTGCACAGC No data
Right 1060126612 9:121053729-121053751 AGAGAGAGCAAAGTGAGTGTGGG No data
1060126604_1060126611 26 Left 1060126604 9:121053679-121053701 CCTCCAACCACAGGCTGCACAGC No data
Right 1060126611 9:121053728-121053750 GAGAGAGAGCAAAGTGAGTGTGG No data
1060126604_1060126608 1 Left 1060126604 9:121053679-121053701 CCTCCAACCACAGGCTGCACAGC No data
Right 1060126608 9:121053703-121053725 GGAAAGAGAATCCGTGTGCTTGG No data
1060126604_1060126609 4 Left 1060126604 9:121053679-121053701 CCTCCAACCACAGGCTGCACAGC No data
Right 1060126609 9:121053706-121053728 AAGAGAATCCGTGTGCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060126604 Original CRISPR GCTGTGCAGCCTGTGGTTGG AGG (reversed) Intergenic
No off target data available for this crispr