ID: 1060126605

View in Genome Browser
Species Human (GRCh38)
Location 9:121053682-121053704
Sequence CCTGCTGTGCAGCCTGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060126605_1060126612 24 Left 1060126605 9:121053682-121053704 CCAACCACAGGCTGCACAGCAGG No data
Right 1060126612 9:121053729-121053751 AGAGAGAGCAAAGTGAGTGTGGG No data
1060126605_1060126608 -2 Left 1060126605 9:121053682-121053704 CCAACCACAGGCTGCACAGCAGG No data
Right 1060126608 9:121053703-121053725 GGAAAGAGAATCCGTGTGCTTGG No data
1060126605_1060126611 23 Left 1060126605 9:121053682-121053704 CCAACCACAGGCTGCACAGCAGG No data
Right 1060126611 9:121053728-121053750 GAGAGAGAGCAAAGTGAGTGTGG No data
1060126605_1060126609 1 Left 1060126605 9:121053682-121053704 CCAACCACAGGCTGCACAGCAGG No data
Right 1060126609 9:121053706-121053728 AAGAGAATCCGTGTGCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060126605 Original CRISPR CCTGCTGTGCAGCCTGTGGT TGG (reversed) Intergenic
No off target data available for this crispr