ID: 1060126610

View in Genome Browser
Species Human (GRCh38)
Location 9:121053714-121053736
Sequence CTCTCTCTCCTCCAAGCACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060126610_1060126611 -9 Left 1060126610 9:121053714-121053736 CCGTGTGCTTGGAGGAGAGAGAG No data
Right 1060126611 9:121053728-121053750 GAGAGAGAGCAAAGTGAGTGTGG No data
1060126610_1060126612 -8 Left 1060126610 9:121053714-121053736 CCGTGTGCTTGGAGGAGAGAGAG No data
Right 1060126612 9:121053729-121053751 AGAGAGAGCAAAGTGAGTGTGGG No data
1060126610_1060126613 4 Left 1060126610 9:121053714-121053736 CCGTGTGCTTGGAGGAGAGAGAG No data
Right 1060126613 9:121053741-121053763 GTGAGTGTGGGACTTTGCACTGG No data
1060126610_1060126614 27 Left 1060126610 9:121053714-121053736 CCGTGTGCTTGGAGGAGAGAGAG No data
Right 1060126614 9:121053764-121053786 AAGTCAGTGCTGCCCCGTCATGG No data
1060126610_1060126615 30 Left 1060126610 9:121053714-121053736 CCGTGTGCTTGGAGGAGAGAGAG No data
Right 1060126615 9:121053767-121053789 TCAGTGCTGCCCCGTCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060126610 Original CRISPR CTCTCTCTCCTCCAAGCACA CGG (reversed) Intergenic
No off target data available for this crispr