ID: 1060126612

View in Genome Browser
Species Human (GRCh38)
Location 9:121053729-121053751
Sequence AGAGAGAGCAAAGTGAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060126605_1060126612 24 Left 1060126605 9:121053682-121053704 CCAACCACAGGCTGCACAGCAGG No data
Right 1060126612 9:121053729-121053751 AGAGAGAGCAAAGTGAGTGTGGG No data
1060126604_1060126612 27 Left 1060126604 9:121053679-121053701 CCTCCAACCACAGGCTGCACAGC No data
Right 1060126612 9:121053729-121053751 AGAGAGAGCAAAGTGAGTGTGGG No data
1060126607_1060126612 20 Left 1060126607 9:121053686-121053708 CCACAGGCTGCACAGCAGGAAAG No data
Right 1060126612 9:121053729-121053751 AGAGAGAGCAAAGTGAGTGTGGG No data
1060126603_1060126612 30 Left 1060126603 9:121053676-121053698 CCTCCTCCAACCACAGGCTGCAC No data
Right 1060126612 9:121053729-121053751 AGAGAGAGCAAAGTGAGTGTGGG No data
1060126610_1060126612 -8 Left 1060126610 9:121053714-121053736 CCGTGTGCTTGGAGGAGAGAGAG No data
Right 1060126612 9:121053729-121053751 AGAGAGAGCAAAGTGAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060126612 Original CRISPR AGAGAGAGCAAAGTGAGTGT GGG Intergenic
No off target data available for this crispr