ID: 1060126879

View in Genome Browser
Species Human (GRCh38)
Location 9:121055827-121055849
Sequence GACACTCTACTGGCCACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060126879_1060126886 16 Left 1060126879 9:121055827-121055849 CCAGCTGTGGCCAGTAGAGTGTC No data
Right 1060126886 9:121055866-121055888 CAGCTCCAGTTAGCCAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060126879 Original CRISPR GACACTCTACTGGCCACAGC TGG (reversed) Intergenic
No off target data available for this crispr