ID: 1060133363

View in Genome Browser
Species Human (GRCh38)
Location 9:121127330-121127352
Sequence ATGCTCAGAAGCAGAACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060133358_1060133363 6 Left 1060133358 9:121127301-121127323 CCTGCACACATCTTGAACACATG 0: 1
1: 0
2: 0
3: 22
4: 207
Right 1060133363 9:121127330-121127352 ATGCTCAGAAGCAGAACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060133363 Original CRISPR ATGCTCAGAAGCAGAACTGT GGG Intronic
No off target data available for this crispr