ID: 1060139142

View in Genome Browser
Species Human (GRCh38)
Location 9:121190816-121190838
Sequence AATGGCTTACTAATACTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060139141_1060139142 -9 Left 1060139141 9:121190802-121190824 CCACTAAATAAGCAAATGGCTTA 0: 1
1: 0
2: 2
3: 24
4: 198
Right 1060139142 9:121190816-121190838 AATGGCTTACTAATACTTACAGG 0: 1
1: 0
2: 1
3: 8
4: 142
1060139139_1060139142 7 Left 1060139139 9:121190786-121190808 CCTAGAGGGGGAAAATCCACTAA 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1060139142 9:121190816-121190838 AATGGCTTACTAATACTTACAGG 0: 1
1: 0
2: 1
3: 8
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060139142 Original CRISPR AATGGCTTACTAATACTTAC AGG Intronic
903052083 1:20608975-20608997 AATGGCTTACACATACATAGTGG - Intronic
903503773 1:23818122-23818144 TATGGCTCCCTAATATTTACAGG + Intronic
904983466 1:34525775-34525797 GTTGGCTTTCTAATACTTACAGG - Intergenic
906493068 1:46283082-46283104 AATGGCTTAATTTTACTTAGTGG - Intronic
906774599 1:48518056-48518078 AAAGGCGTACAAATACATACAGG - Intergenic
907235952 1:53047883-53047905 AATGGCTGACTCAGACTTCCTGG + Exonic
907934435 1:59029748-59029770 AATGGCTCCGTATTACTTACAGG + Intergenic
908548088 1:65181725-65181747 AATGGCTTCCTATCATTTACTGG - Intronic
908550063 1:65199780-65199802 AATGTCTGCCTTATACTTACTGG + Intronic
908787181 1:67746731-67746753 AATTACTTACTAATACTCTCTGG - Intronic
909124077 1:71642922-71642944 AAAGTCTCAGTAATACTTACAGG - Intronic
909153460 1:72039263-72039285 AATGGCTTCCCAGTGCTTACAGG - Intronic
909612232 1:77563620-77563642 AATGGCTTTCCAAAACTAACTGG + Intronic
910037988 1:82811867-82811889 AATGTCTGACTAATTCTTATAGG + Intergenic
912206669 1:107516492-107516514 AATGCCTTCCTAATTATTACTGG + Intergenic
912261533 1:108115715-108115737 AATTGTGTACTAATACTAACAGG - Intergenic
912828650 1:112930047-112930069 AAACGCTTACTAATATTTGCTGG - Intronic
918149282 1:181784201-181784223 ACAGGCTTACTACTACTTCCAGG + Intronic
918662269 1:187104326-187104348 AATTGCTTACTAATCTTAACAGG - Intergenic
919559990 1:199105436-199105458 AATGGTTAACTCCTACTTACAGG + Intergenic
922150337 1:222996960-222996982 CATGGCGTACTATTGCTTACTGG - Intronic
924765284 1:247026282-247026304 AAAGGCGTACAAATACATACAGG + Intergenic
1065494418 10:26314267-26314289 ATTGGCTTAGTGATACTTATGGG + Intergenic
1070029624 10:72664359-72664381 ATTGGCTTGCTACTACATACAGG - Intergenic
1070077293 10:73149852-73149874 AACGGCTTGATAATACATACTGG - Intronic
1070422286 10:76248829-76248851 AATGTCATATTAATAATTACAGG - Intronic
1073670989 10:105588386-105588408 AATGGCTTAACAGTACTTTCTGG - Intergenic
1073820214 10:107253528-107253550 ATTGTCTTACTAATAATTATAGG - Intergenic
1074931943 10:118136611-118136633 AATGGCTTAATAATATGAACAGG - Intergenic
1075846445 10:125548846-125548868 AATGGCTAACTGATACAGACAGG - Intergenic
1076286103 10:129298073-129298095 AGTGGCTTACTTATACTGGCCGG + Intergenic
1079841648 11:25408795-25408817 CATGTCTTCCCAATACTTACAGG + Intergenic
1081037146 11:38162818-38162840 AATGGCTTACTCATTGATACTGG - Intergenic
1082741473 11:56916425-56916447 AATGTCTTATTTATACTCACTGG + Intergenic
1082811210 11:57480125-57480147 AATGGCTTCCTAATGCCTATAGG + Intergenic
1085364021 11:75920895-75920917 AATGGCTTAATAATAGTCAGTGG + Intronic
1086612974 11:88779247-88779269 AAAGGCTAAATAATCCTTACAGG - Intronic
1087221110 11:95547206-95547228 ACTGGCATACTCATACTCACTGG - Intergenic
1090742186 11:129674482-129674504 AAACGCTTACTTATATTTACTGG - Intergenic
1092521388 12:9277101-9277123 AATGACTTGCTGATACTTCCTGG + Intergenic
1093029770 12:14277523-14277545 AATGGATTCCTAATAGATACAGG - Intergenic
1093542383 12:20302747-20302769 TATGACTTTCTAATAATTACCGG - Intergenic
1093587821 12:20862734-20862756 AATTGTTTTGTAATACTTACAGG + Exonic
1096308075 12:50496651-50496673 AAAGGCGTACAAATACATACAGG - Intergenic
1096450682 12:51738733-51738755 AAAGGCGTACAAATACATACAGG - Intronic
1101499917 12:105293899-105293921 CATGGCTTAATAATACCTCCAGG + Intronic
1105664675 13:22540615-22540637 AATGTCCTACTAATAATTATTGG + Intergenic
1111913342 13:94336003-94336025 AATGTCTAACTAATACTTCCTGG - Intronic
1112895989 13:104301438-104301460 AATTGTTTACAAGTACTTACAGG - Intergenic
1114806970 14:25848647-25848669 AATCCCTTAGTAATACTAACTGG - Intergenic
1115490422 14:33952872-33952894 AATGGCTAATAAATAGTTACTGG + Intronic
1118123024 14:62867330-62867352 AATGGCTTCCTAACACCCACAGG + Intronic
1118985038 14:70747122-70747144 AATGACTTACAAATAATTTCTGG - Intronic
1120144965 14:80969444-80969466 AATGAATTACTATTTCTTACAGG + Intronic
1120648254 14:87099146-87099168 AATGAGTTACTCATACTTCCTGG + Intergenic
1121304265 14:92896084-92896106 AATAGATGACTAATACTAACAGG + Intergenic
1124452874 15:29812961-29812983 ATTGGAGTATTAATACTTACTGG - Intronic
1127297484 15:57621688-57621710 AATGACTTACTGATAGTTCCTGG - Exonic
1127578929 15:60319269-60319291 AAGGGATAACTAATACTTGCTGG - Intergenic
1131702263 15:94950827-94950849 CAAAGCTTACTAATACTTATAGG - Intergenic
1143430465 17:6879330-6879352 AAAGGCATACAAATACATACAGG - Intronic
1144491385 17:15713758-15713780 GATGGCTTCCTAAAACTTAAAGG - Intronic
1144909100 17:18665445-18665467 GATGGCTTCCTAAAACTTAAAGG + Intronic
1149078147 17:52621548-52621570 AATGTCTTAATATTACATACAGG - Intergenic
1149938529 17:60836568-60836590 AATTGCTTACTAAACCTTCCAGG - Intronic
1150486425 17:65546852-65546874 ATAGGCTTATTAATACTCACAGG + Intronic
1150509537 17:65735946-65735968 AATGGCTTTCCATTACCTACAGG - Intronic
1151457966 17:74237935-74237957 AATGGCTTATCAAGACTTTCTGG - Intronic
1155321988 18:24628724-24628746 AGTGCCTTACTCATCCTTACAGG - Intergenic
1155629917 18:27881251-27881273 AAACACTTAGTAATACTTACTGG + Intergenic
1156773067 18:40753199-40753221 AATGGTTTACTAGTAATGACAGG + Intergenic
1157381340 18:47221073-47221095 AATGGCTTTCCAACACTTTCAGG + Intronic
1158147219 18:54328262-54328284 AAAGCCTTTCTAATATTTACTGG + Intronic
1162283104 19:9716331-9716353 AAAGGCATACAAATACATACAGG - Intergenic
1163896275 19:20062967-20062989 CATGGGATACTAATACTAACAGG + Intergenic
1164024901 19:21343082-21343104 AAAGGCATACAAATACATACAGG - Intergenic
1165002868 19:32779344-32779366 AACCGCTTACTGGTACTTACAGG - Intronic
930656240 2:54009779-54009801 AATGGAATACTGATACTAACTGG + Intronic
937548304 2:123052866-123052888 AATTGCTTGCTATTCCTTACAGG + Intergenic
937870019 2:126780041-126780063 AGTGGCTATCTACTACTTACAGG - Intergenic
942627887 2:177922722-177922744 CATGGCTTCCTATTGCTTACAGG + Intronic
942702193 2:178725302-178725324 AATGAATTACTAAGAGTTACTGG - Intronic
942883590 2:180894337-180894359 AAATGCTTAATAATAATTACTGG - Intergenic
943772187 2:191730526-191730548 AATGGCTTACAAGACCTTACAGG - Intergenic
945029962 2:205654329-205654351 AATGTCGTACGAATACTGACAGG + Intergenic
945908613 2:215621325-215621347 TGTGTCTTACTTATACTTACGGG - Intergenic
946852793 2:223923442-223923464 AATAGTTTAGTAATATTTACAGG + Intronic
947114495 2:226754251-226754273 AATGGTTTACTAAAATATACTGG - Intronic
948733721 2:239984260-239984282 AATGAATTAATAATACTTACTGG - Intronic
1173067080 20:39723255-39723277 AAAGGCATACAAATACATACAGG + Intergenic
1174931912 20:54825669-54825691 AATGGCTTCCTATTGCTTTCAGG + Intergenic
1177755338 21:25340520-25340542 AAGGGCTTACAAATAACTACAGG - Intergenic
1182638254 22:31746668-31746690 AAAAACTGACTAATACTTACAGG + Intronic
954549049 3:51464969-51464991 AATGGCTTTCTATTACCTTCAGG - Intronic
955194667 3:56794158-56794180 AGTGGTTTTCAAATACTTACAGG + Intronic
962025327 3:131541459-131541481 ACTGACTTACTATTTCTTACTGG + Intronic
963726555 3:148928818-148928840 AAAGGCTTTTTAATATTTACAGG + Intergenic
965195882 3:165593852-165593874 AATAGCTTGCCAATACTTAGAGG - Intergenic
966937737 3:184724696-184724718 AATGGGATAATAATACTTACAGG + Intergenic
972989217 4:44803020-44803042 TATGGCTTAGTAACACTTACAGG - Intergenic
974058646 4:57009883-57009905 CATCCATTACTAATACTTACAGG - Intronic
975648004 4:76564666-76564688 AATGGGTTACATATGCTTACTGG + Intronic
982071332 4:151697489-151697511 AAGGGATGACAAATACTTACTGG + Intronic
986014989 5:3749732-3749754 AGTGGCTTTCCAATAATTACTGG + Intergenic
987575123 5:19716952-19716974 AATGGCTTAGTAGTATTTACTGG + Intronic
989122065 5:38014836-38014858 AGTGGCTTGCCATTACTTACAGG + Intergenic
989414687 5:41160122-41160144 AATAGATTCCTGATACTTACTGG + Exonic
996291682 5:121859424-121859446 AAAGGCGTACAAATACATACAGG - Intergenic
996476231 5:123925434-123925456 AGGGGGTTAATAATACTTACTGG - Intergenic
996623259 5:125536933-125536955 CACAGCTTACCAATACTTACAGG + Intergenic
997129025 5:131257904-131257926 AATGGCTTCCTAACACACACTGG + Intronic
998392995 5:141799580-141799602 ATTGGGTTAATAATACTTAGAGG - Intergenic
1003609497 6:7596855-7596877 AAAGGGTTAATAATACTTAAAGG + Intronic
1004913225 6:20306945-20306967 AATGGCTTTCTATTGCTTTCAGG - Intergenic
1005858187 6:29880295-29880317 AAAGGCGTACAAATACATACAGG - Intergenic
1006188711 6:32195037-32195059 AATGGCTGACAAATATTTATTGG - Exonic
1009920067 6:70046396-70046418 AATGGCCTACAAAGTCTTACAGG + Intronic
1010770280 6:79820388-79820410 AATCTCCTACTAATACTTCCAGG - Intergenic
1011385007 6:86786520-86786542 AATGGCTTACTACTACCAATAGG + Intergenic
1013584429 6:111565893-111565915 AATGGGTCACTAATACTTACAGG - Intronic
1016963581 6:149697137-149697159 AATGGCTTAGTAAGACTAATGGG + Intronic
1020868518 7:13596926-13596948 AATGGCTCACCAATACTGATAGG - Intergenic
1022141529 7:27497132-27497154 CATGTCTAACTAATTCTTACGGG - Intergenic
1022760722 7:33346819-33346841 AATGGCTTATTACTACTTAAAGG + Intronic
1025857200 7:65291739-65291761 ATTGGCTAAGTAATACTTAATGG - Intergenic
1027622633 7:80509691-80509713 AATGGACTACTGATACATACAGG - Intronic
1030197375 7:106865774-106865796 ACAGGCTGACTAATACTCACTGG - Exonic
1030396047 7:108988271-108988293 AATGGCTTGGTAATCTTTACTGG - Intergenic
1032875170 7:136030906-136030928 AATGACATACTAATACCTACAGG + Intergenic
1033423485 7:141222805-141222827 AGTGGCTGACTATTATTTACTGG + Intronic
1038685963 8:29718790-29718812 AATGGCTTTCTAATTATTTCTGG - Intergenic
1044099480 8:88115764-88115786 ACTGGCTTACAAATACTGAGGGG + Intronic
1044446716 8:92286225-92286247 AGTGGCTTCCAGATACTTACAGG + Intergenic
1046694265 8:117320941-117320963 AATGGGCTACTAGTACATACTGG + Intergenic
1048078960 8:131103681-131103703 AATAGTTTAATTATACTTACTGG + Intergenic
1051028929 9:12650253-12650275 TATGCCTTCCTAATACTTCCTGG - Intergenic
1051271237 9:15356922-15356944 AATGATCTACTAATACTTAATGG - Intergenic
1055556350 9:77477501-77477523 AAAGCCTAACTAATAATTACAGG + Intronic
1056175516 9:84031125-84031147 AATAGCTTAATAATATTTAGTGG - Intergenic
1057343879 9:94229990-94230012 GATGAGTTACTAATACTTCCAGG + Intergenic
1060139142 9:121190816-121190838 AATGGCTTACTAATACTTACAGG + Intronic
1060393188 9:123296360-123296382 AGTGGCTCACTATTACCTACAGG + Intergenic
1061633102 9:131886014-131886036 AATGGCTTCCCAATGCTTTCTGG - Intronic
1190394728 X:49969544-49969566 AATGGCTTCCAAATATTTAGTGG + Intronic
1190459536 X:50658564-50658586 ACTGGCTTCCTAGTACTTATGGG + Intronic
1190477261 X:50840427-50840449 AATGGGTTACAAATAAGTACAGG - Intergenic
1191223367 X:58015174-58015196 AATGGCTGACTAAAAGTGACTGG + Intergenic
1191833631 X:65441643-65441665 AAAGGCATACAAATACATACAGG - Intronic
1191989364 X:67017790-67017812 ACTGGCTTAGTAATACTGATTGG - Intergenic
1194754847 X:97726712-97726734 AATGGTTTTCTATTGCTTACAGG - Intergenic
1199581689 X:149366952-149366974 AATGGCTTTATAATACCTTCAGG + Intergenic
1201926704 Y:19295219-19295241 AATGGGGTACAAATACATACAGG + Intergenic