ID: 1060144748

View in Genome Browser
Species Human (GRCh38)
Location 9:121242399-121242421
Sequence TGAGTCACCAAGGTTAAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 173}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060144748_1060144751 -9 Left 1060144748 9:121242399-121242421 CCTCATTTAACCTTGGTGACTCA 0: 1
1: 0
2: 1
3: 15
4: 173
Right 1060144751 9:121242413-121242435 GGTGACTCACAGAGTTCGGCTGG No data
1060144748_1060144758 17 Left 1060144748 9:121242399-121242421 CCTCATTTAACCTTGGTGACTCA 0: 1
1: 0
2: 1
3: 15
4: 173
Right 1060144758 9:121242439-121242461 TGCTGTCCTCTGGAAAAAGGGGG No data
1060144748_1060144754 14 Left 1060144748 9:121242399-121242421 CCTCATTTAACCTTGGTGACTCA 0: 1
1: 0
2: 1
3: 15
4: 173
Right 1060144754 9:121242436-121242458 GCCTGCTGTCCTCTGGAAAAAGG No data
1060144748_1060144756 15 Left 1060144748 9:121242399-121242421 CCTCATTTAACCTTGGTGACTCA 0: 1
1: 0
2: 1
3: 15
4: 173
Right 1060144756 9:121242437-121242459 CCTGCTGTCCTCTGGAAAAAGGG No data
1060144748_1060144757 16 Left 1060144748 9:121242399-121242421 CCTCATTTAACCTTGGTGACTCA 0: 1
1: 0
2: 1
3: 15
4: 173
Right 1060144757 9:121242438-121242460 CTGCTGTCCTCTGGAAAAAGGGG No data
1060144748_1060144753 7 Left 1060144748 9:121242399-121242421 CCTCATTTAACCTTGGTGACTCA 0: 1
1: 0
2: 1
3: 15
4: 173
Right 1060144753 9:121242429-121242451 CGGCTGGGCCTGCTGTCCTCTGG No data
1060144748_1060144760 24 Left 1060144748 9:121242399-121242421 CCTCATTTAACCTTGGTGACTCA 0: 1
1: 0
2: 1
3: 15
4: 173
Right 1060144760 9:121242446-121242468 CTCTGGAAAAAGGGGGATAGAGG No data
1060144748_1060144752 -8 Left 1060144748 9:121242399-121242421 CCTCATTTAACCTTGGTGACTCA 0: 1
1: 0
2: 1
3: 15
4: 173
Right 1060144752 9:121242414-121242436 GTGACTCACAGAGTTCGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060144748 Original CRISPR TGAGTCACCAAGGTTAAATG AGG (reversed) Intronic
900390839 1:2433133-2433155 TGAGCCAGCAAAGGTAAATGGGG + Intronic
903673898 1:25052533-25052555 GGAGTAATTAAGGTTAAATGAGG + Intergenic
905340595 1:37274837-37274859 TGAGCCACACAGGCTAAATGTGG - Intergenic
909760369 1:79278502-79278524 TGAGTAACAAAGGGTAAATGTGG - Intergenic
909809002 1:79907261-79907283 TGAATCATCCAGGTTGAATGGGG + Intergenic
913173826 1:116256118-116256140 TGAGTCACCAAGCCTAAAATAGG + Intergenic
914222920 1:145696444-145696466 GAAGTAACAAAGGTTAAATGAGG + Intronic
916757595 1:167787996-167788018 TGGGTCTCCAAGGCTACATGTGG - Exonic
918586499 1:186194316-186194338 GGAGTAACTAAGGTTAAATGAGG + Intergenic
919301403 1:195771647-195771669 CTAGTCACCAAAGTTAAATTTGG - Intergenic
920573558 1:207037309-207037331 AGAGCCACCAAGGATAACTGAGG - Intronic
922949292 1:229544735-229544757 AAAGTAACTAAGGTTAAATGAGG + Intronic
924461333 1:244261574-244261596 TGAGGGACAAAGGTGAAATGGGG + Intergenic
1065306735 10:24376392-24376414 TGACTCAACGAGGTTATATGTGG + Intronic
1065484493 10:26224499-26224521 TGAGTTACAGAGGTAAAATGTGG + Intronic
1065920443 10:30388093-30388115 GGAGTCATTAAGGTTGAATGAGG - Intergenic
1066693202 10:38053469-38053491 AGATTAACTAAGGTTAAATGAGG - Intronic
1068501932 10:57850643-57850665 TGATTGCCCAAGGTTACATGAGG + Intergenic
1069172536 10:65251624-65251646 TGAATGACCAAAGTAAAATGAGG + Intergenic
1074248233 10:111715088-111715110 TGAGTCAGGAAGGTTAGAGGGGG - Intergenic
1076382550 10:130035354-130035376 AAAGTAACAAAGGTTAAATGAGG - Intergenic
1081200951 11:40214543-40214565 GGAGTAATCAAGGTTAAATGAGG + Intronic
1082038698 11:47666955-47666977 TGAAAACCCAAGGTTAAATGAGG - Exonic
1084509037 11:69591504-69591526 TAAGTGACTAGGGTTAAATGAGG + Intergenic
1085949756 11:81315679-81315701 GAAGTAACTAAGGTTAAATGAGG - Intergenic
1086304275 11:85462864-85462886 GAAGTCATTAAGGTTAAATGAGG + Intronic
1086328190 11:85726084-85726106 TGAGTCATCAAAGGAAAATGTGG - Intronic
1087389280 11:97513725-97513747 ACAGGCACCAAAGTTAAATGAGG - Intergenic
1090461632 11:126896376-126896398 TCAGAGACCAAGGTCAAATGTGG - Intronic
1091271910 11:134320525-134320547 TGAGAAACCAAGGTTCAAAGAGG + Intergenic
1091401311 12:182325-182347 AGAGTCAGGGAGGTTAAATGAGG + Intergenic
1093511715 12:19936847-19936869 TGAGGCACCAAGGTCAGAAGCGG + Intergenic
1095310231 12:40689746-40689768 TGAGTAACCAAAGAGAAATGTGG - Intergenic
1098855578 12:75649499-75649521 TAAGTTACCAAGGTTATAAGTGG - Intergenic
1101957545 12:109224256-109224278 TGAGTCAGAAAGTTTAGATGAGG - Intronic
1104409663 12:128547616-128547638 TGAGTCACCAATTTGAGATGTGG + Intronic
1105449023 13:20482305-20482327 AGAGTTACGAAGTTTAAATGGGG - Intronic
1106837803 13:33654746-33654768 TGACTAACCAAGGTAAAATCAGG - Intergenic
1107541747 13:41395219-41395241 TGAGCAAACAAGGTTCAATGAGG + Intergenic
1109594540 13:64532888-64532910 TGAGTCCACAAGCTTGAATGTGG - Intergenic
1110257203 13:73445286-73445308 TGAGACAACCAGGTGAAATGTGG + Intergenic
1111561274 13:89951463-89951485 AAAGTAACTAAGGTTAAATGAGG + Intergenic
1112831049 13:103451792-103451814 TGAATCACCAAGAGTCAATGGGG - Intergenic
1113027757 13:105959664-105959686 TAAGTCATCAAGGGAAAATGGGG + Intergenic
1115099592 14:29682784-29682806 TGAGTCTTGAAGGGTAAATGTGG + Intronic
1115786465 14:36831601-36831623 TCAGTCACCAAGTTTATATGAGG - Intronic
1116165677 14:41331634-41331656 ATATTCTCCAAGGTTAAATGGGG - Intergenic
1116443506 14:44981466-44981488 GGAGTCATCAGTGTTAAATGTGG + Intronic
1117499798 14:56340153-56340175 TGACTCAGCAAAGTCAAATGAGG + Intergenic
1119713138 14:76837582-76837604 TGAAGCACCAAGGCTAAATTGGG + Intronic
1129405210 15:75312459-75312481 GAAGTCATAAAGGTTAAATGAGG + Intergenic
1130510214 15:84582984-84583006 GAAGTCATTAAGGTTAAATGAGG - Intergenic
1130584867 15:85173015-85173037 GAAGTCATTAAGGTTAAATGAGG + Intergenic
1132225546 15:100138105-100138127 TGAGACACCCAGGTTAAACCAGG + Intronic
1133577803 16:7110662-7110684 TCATTCACCATAGTTAAATGAGG + Intronic
1134304556 16:13020544-13020566 GAAGTCATTAAGGTTAAATGAGG - Intronic
1137908576 16:52351907-52351929 TGAGTCACAAAGTTTATTTGGGG + Intergenic
1140710463 16:77672624-77672646 AGAGTCAACAAGGTTAAAGAAGG + Intergenic
1141070886 16:80953503-80953525 TGAGTTACCAAAGGTATATGGGG + Intergenic
1148068597 17:44892499-44892521 TGAGTTACAGAGGTTAACTGGGG + Intronic
1150982673 17:70160152-70160174 TGAGTCACCAAGTTTTAGTAAGG - Intergenic
1150991502 17:70264923-70264945 TAGGTAATCAAGGTTAAATGAGG - Intergenic
1153294046 18:3528752-3528774 AGAGTCACCAATTTCAAATGCGG - Intronic
1156560342 18:38118181-38118203 TGGGTAATGAAGGTTAAATGAGG + Intergenic
1156860455 18:41829864-41829886 TGAGTCACCAAGGGGAAACGGGG + Intergenic
1157465411 18:47940063-47940085 TGAGTCACCAGGGCTAGCTGCGG + Intergenic
1158357006 18:56632453-56632475 AGAGTCATAAAGCTTAAATGAGG - Intronic
1160032027 18:75270228-75270250 TGAGGCACAGAGGTTAAGTGAGG - Intronic
1164450404 19:28357323-28357345 AGAGTAAGTAAGGTTAAATGAGG - Intergenic
1165596015 19:37011747-37011769 TGTGTCACCAAGGCCATATGGGG - Intronic
925734141 2:6945646-6945668 TGAGGCTCCCAGGATAAATGAGG + Intronic
928071383 2:28221048-28221070 AGAGACACCTAGGTTAACTGAGG - Intronic
930638151 2:53828481-53828503 GAAGTAATCAAGGTTAAATGAGG + Intergenic
930852114 2:55972529-55972551 TCAGTTACCAAGGGTAAATCAGG - Intergenic
933326917 2:80849652-80849674 TGTGCCACCAAGTTTAATTGTGG + Intergenic
934784155 2:96992532-96992554 TGAGTGACCAATGTGGAATGAGG + Intronic
935635891 2:105249563-105249585 TGTGTCTGAAAGGTTAAATGTGG - Intergenic
936585550 2:113754695-113754717 TGAGTCAGCAAGCATAAATGTGG + Intronic
936626110 2:114151165-114151187 TCAGTCACCAAGGTTTATTAGGG - Intergenic
937802632 2:126098026-126098048 TGAGTCATCAAGTGTTAATGGGG + Intergenic
938207507 2:129436853-129436875 TGAGTCTCCTAGGCTAAAGGAGG - Intergenic
939179049 2:138782539-138782561 AGAGACACCAAGTCTAAATGAGG - Intergenic
942176363 2:173338617-173338639 GGAGTCCCCAAAGTTAACTGTGG + Intergenic
942689876 2:178574038-178574060 TGAGGCACCAAAGATAAAGGTGG - Exonic
942740062 2:179166109-179166131 TGAATCACTAAGGCCAAATGTGG + Intronic
943729228 2:191284403-191284425 TAAGTCACCAAGGTTCAAACAGG - Intronic
943973643 2:194443150-194443172 TAAGTGATTAAGGTTAAATGAGG - Intergenic
944040178 2:195344622-195344644 TGAGTTACCCACGTTTAATGTGG - Intergenic
944157460 2:196622315-196622337 TGTGTCCCCAGAGTTAAATGGGG - Intergenic
946298350 2:218805044-218805066 GAAGTAACTAAGGTTAAATGGGG - Intronic
947950431 2:234142415-234142437 GGAGTAATTAAGGTTAAATGAGG + Intergenic
1172231071 20:33336504-33336526 TGAGTGAGCCAGGTAAAATGTGG + Intergenic
1173387808 20:42604999-42605021 TGAGACTCCAAGGTCAAAGGAGG + Intronic
1173790999 20:45827623-45827645 TGAGGCAGCATGGTAAAATGGGG + Intronic
1175534533 20:59699369-59699391 GGAGTCACAAGGGGTAAATGAGG - Intronic
1177734317 21:25070015-25070037 GCAGTCATTAAGGTTAAATGAGG + Intergenic
1180842360 22:18965277-18965299 TGAGTCACCATGGCAGAATGTGG + Intergenic
1181271664 22:21662176-21662198 TGAGTCACACAGGCTAAGTGGGG + Intronic
1183288978 22:36986544-36986566 TGAGTCACAATGGGCAAATGAGG + Intergenic
949186311 3:1196103-1196125 TCAGTCACCAAGGTTAAAGGAGG - Intronic
949789711 3:7779774-7779796 TGATTCCCCAATGTTAAAGGTGG + Intergenic
952966321 3:38623229-38623251 TGAGCCACCAGGGCTAAAAGAGG - Intronic
954495125 3:50951177-50951199 AGACTCACCAATGCTAAATGAGG - Intronic
958991019 3:100845095-100845117 TGAGTCACCAAATTTAAATAAGG - Intronic
959659299 3:108848063-108848085 TGATTCTCCAAAGTGAAATGGGG - Intronic
960361415 3:116716406-116716428 TGAATCACCAAGGAAACATGAGG + Intronic
961811354 3:129523596-129523618 TGCGTCACCAAGGCTACATGAGG - Intergenic
962136547 3:132740858-132740880 TGAATAACCAAGGATATATGTGG - Intergenic
964464298 3:156972868-156972890 TCATTCACCAAGGCCAAATGAGG + Intronic
965567182 3:170132478-170132500 GAAGTAACAAAGGTTAAATGAGG + Intronic
966450903 3:180060274-180060296 GGAGTGACCAAGTTAAAATGAGG - Intergenic
968827177 4:2907594-2907616 TGAGTGACCCAGATTAGATGTGG + Intronic
970668997 4:18374620-18374642 GAAGTAACAAAGGTTAAATGAGG + Intergenic
971796680 4:31237362-31237384 TGAGTCACCATTGTTAGAAGTGG - Intergenic
971902998 4:32686535-32686557 TGAGTCACCAACTTAAAATAAGG + Intergenic
974887543 4:67838934-67838956 CAAGTCACCAAGGTTTATTGTGG - Intronic
975139736 4:70906796-70906818 TGAGTCCACAAAATTAAATGAGG - Intronic
975485221 4:74927957-74927979 TAAGTAATTAAGGTTAAATGAGG + Intergenic
976698486 4:87943603-87943625 TGAGTAAACAAGGTGAAATATGG + Intergenic
978673989 4:111287586-111287608 TGAGTAACCCAGTTTAAATGCGG - Intergenic
981241527 4:142482058-142482080 TGGCTCACCAGTGTTAAATGTGG - Intronic
981345077 4:143665273-143665295 TGAGTCATCAAGGATGAATAAGG + Intronic
981742313 4:148015585-148015607 TGAATCACCATGACTAAATGAGG - Intronic
981801815 4:148666549-148666571 TGAGTTAAGAAGGTTAAAGGGGG + Intergenic
984533844 4:180947581-180947603 TCAGTCACTAAAGTGAAATGAGG - Intergenic
985134991 4:186777706-186777728 TGAGTTACAAATGTTAAATATGG - Intergenic
987412453 5:17627907-17627929 TGAGTGAGTAAAGTTAAATGGGG - Intergenic
988453381 5:31365006-31365028 TGAGTCACCAAAGCTCACTGGGG - Intergenic
988934572 5:36069065-36069087 GGGGTAAACAAGGTTAAATGTGG + Intronic
992240213 5:74761410-74761432 TGAGTCAGAAAGGTTAAATAAGG + Intronic
993763033 5:91820442-91820464 TGAGACACCAAGATAAAATGAGG + Intergenic
993943671 5:94093526-94093548 GAAGTCATTAAGGTTAAATGAGG - Intronic
996480454 5:123969942-123969964 TAAGTAATTAAGGTTAAATGAGG + Intergenic
999392086 5:151200615-151200637 TGAGTGACCAAGTTAGAATGAGG + Intronic
999959802 5:156742294-156742316 TGAGTCATCAAGCAGAAATGTGG - Intronic
1001367967 5:171163230-171163252 TTAGTCACCCAGGATTAATGTGG + Intronic
1002856464 6:1042455-1042477 TGGGTCAGCAAGCCTAAATGTGG + Intergenic
1004931511 6:20467179-20467201 TGTGGCAACAAGGTTAAATGGGG + Intronic
1004981398 6:21028618-21028640 TAGGTAACTAAGGTTAAATGAGG - Intronic
1006185429 6:32178977-32178999 TGAGACACAAAGGTTAAGGGAGG + Intronic
1006485945 6:34341977-34341999 TAAGTCACAAAGGTTGCATGGGG + Intronic
1008494728 6:52121559-52121581 AGAGTTACCCAGGTTAAAAGGGG - Intergenic
1012160970 6:95885772-95885794 GAAGTCATTAAGGTTAAATGAGG - Intergenic
1013941764 6:115672356-115672378 TCAGTGACCAAGGGGAAATGAGG + Intergenic
1015483835 6:133745955-133745977 TGAGTCACCAATGTGGAACGAGG - Intergenic
1015873042 6:137796223-137796245 GGAGTAATTAAGGTTAAATGAGG + Intergenic
1020220169 7:6230279-6230301 TGAGGCACCAATGTTAATAGTGG - Intronic
1020578799 7:9968821-9968843 AAAGTAATCAAGGTTAAATGAGG + Intergenic
1022617871 7:31951157-31951179 TAAGTAATTAAGGTTAAATGAGG - Intronic
1025795468 7:64735836-64735858 TGGGTCTCCAAGGCTACATGTGG + Intergenic
1026387838 7:69868507-69868529 TCTGTCACCCAGGTTATATGTGG + Intronic
1027055498 7:75046736-75046758 AGAGTCACCAAGGCTAAATATGG - Intronic
1027394286 7:77738512-77738534 AGTGTTACCAAGATTAAATGAGG + Intronic
1029872714 7:103712014-103712036 TGAGTCCCTGAGGTTTAATGAGG - Intronic
1030155693 7:106452185-106452207 TGAGGCACCAAGGTAACTTGGGG + Intergenic
1035238378 7:157514890-157514912 GGACTCACTAAGGTTAGATGAGG - Intergenic
1035966375 8:4196639-4196661 TGGGTCACAAAGATTCAATGAGG - Intronic
1036295305 8:7529929-7529951 ATAGGCACCAAAGTTAAATGAGG - Intergenic
1036327265 8:7791089-7791111 ATAGGCACCAAAGTTAAATGAGG + Intergenic
1037681135 8:21098525-21098547 AGAGTAATCAAGGTTAAATGAGG - Intergenic
1039208763 8:35187267-35187289 GGAGTGATAAAGGTTAAATGAGG - Intergenic
1040033875 8:42850228-42850250 TGAGCAACCAAGGTCACATGGGG + Intronic
1041924106 8:63218336-63218358 TTAGACACCAAGGTTAAGTGGGG - Intergenic
1044056618 8:87578647-87578669 TGAGAGACCTAGGCTAAATGAGG + Intronic
1044532748 8:93326409-93326431 TGAATCACCAAGATGAATTGTGG + Intergenic
1048043734 8:130754251-130754273 TGAGTCCCCAAGGTGGCATGTGG + Intergenic
1048505434 8:135016481-135016503 AGAGGCACCCAGGTTCAATGTGG - Intergenic
1050412914 9:5385007-5385029 GAAGTCACCAAGGTGAGATGAGG + Intronic
1052461779 9:28773723-28773745 TGAATCACCAAAATTAGATGTGG + Intergenic
1053678618 9:40464295-40464317 TGAGAAAAGAAGGTTAAATGAGG + Intergenic
1053928602 9:43092649-43092671 TGAGAAAAGAAGGTTAAATGAGG + Intergenic
1054285106 9:63160647-63160669 TGAGAAAAGAAGGTTAAATGAGG - Intergenic
1054291696 9:63299833-63299855 TGAGAAAAGAAGGTTAAATGAGG + Intergenic
1054389712 9:64604376-64604398 TGAGAAAAGAAGGTTAAATGAGG + Intergenic
1054506000 9:65912000-65912022 TGAGAAAAGAAGGTTAAATGAGG - Intergenic
1057783835 9:98072133-98072155 TGCGGCTCCAAGGTTACATGAGG - Intronic
1059029419 9:110675123-110675145 TGAGACACTGAGGTTAAGTGTGG + Intronic
1060144748 9:121242399-121242421 TGAGTCACCAAGGTTAAATGAGG - Intronic
1060187117 9:121570441-121570463 GGAGTAATTAAGGTTAAATGAGG - Intronic
1060886660 9:127159315-127159337 TGGCTCCCCAAGGTGAAATGAGG - Intronic
1186964800 X:14775574-14775596 TGTGTCACCAAGGAGAACTGAGG + Intergenic
1188189117 X:27152470-27152492 GGGGTCAATAAGGTTAAATGAGG - Intergenic
1188355904 X:29191152-29191174 TGATCAAACAAGGTTAAATGTGG + Intronic
1190142868 X:47863321-47863343 TGAGCCAACAAAGTTACATGTGG - Intronic
1194164095 X:90492325-90492347 TAAGTCACCAATGTAAAAGGTGG - Intergenic
1198263122 X:134984218-134984240 GAAGTAACTAAGGTTAAATGAGG - Intergenic
1199671917 X:150154821-150154843 TGTGTCACCAAGGATAAAGCAGG - Intergenic
1200078335 X:153563026-153563048 GAAGTGATCAAGGTTAAATGAGG - Intronic
1200510354 Y:4070129-4070151 TAAGTCACCAATGTAAAAGGTGG - Intergenic
1202582911 Y:26400966-26400988 TGCCACACCAAGGTAAAATGAGG + Intergenic