ID: 1060144749

View in Genome Browser
Species Human (GRCh38)
Location 9:121242409-121242431
Sequence CCGAACTCTGTGAGTCACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 73}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060144749_1060144757 6 Left 1060144749 9:121242409-121242431 CCTTGGTGACTCACAGAGTTCGG 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1060144757 9:121242438-121242460 CTGCTGTCCTCTGGAAAAAGGGG No data
1060144749_1060144753 -3 Left 1060144749 9:121242409-121242431 CCTTGGTGACTCACAGAGTTCGG 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1060144753 9:121242429-121242451 CGGCTGGGCCTGCTGTCCTCTGG No data
1060144749_1060144756 5 Left 1060144749 9:121242409-121242431 CCTTGGTGACTCACAGAGTTCGG 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1060144756 9:121242437-121242459 CCTGCTGTCCTCTGGAAAAAGGG No data
1060144749_1060144760 14 Left 1060144749 9:121242409-121242431 CCTTGGTGACTCACAGAGTTCGG 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1060144760 9:121242446-121242468 CTCTGGAAAAAGGGGGATAGAGG No data
1060144749_1060144758 7 Left 1060144749 9:121242409-121242431 CCTTGGTGACTCACAGAGTTCGG 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1060144758 9:121242439-121242461 TGCTGTCCTCTGGAAAAAGGGGG No data
1060144749_1060144754 4 Left 1060144749 9:121242409-121242431 CCTTGGTGACTCACAGAGTTCGG 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1060144754 9:121242436-121242458 GCCTGCTGTCCTCTGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060144749 Original CRISPR CCGAACTCTGTGAGTCACCA AGG (reversed) Intronic
900537881 1:3187733-3187755 CAGGACTCTGTGAGCTACCAAGG - Intronic
906499981 1:46334629-46334651 CCCAACTCTTTGAGTGGCCAAGG + Intergenic
916874992 1:168959610-168959632 CAGAACTCTTTGTGTCCCCAAGG - Intergenic
918984646 1:191608452-191608474 CCAAACTCTCTGAGTCATCCTGG - Intergenic
920452911 1:206073700-206073722 TGGAAATCTGTGAGTCACCCTGG + Intronic
923500768 1:234561659-234561681 CAGAAATCTGGGAGTCACCCTGG - Intergenic
1067397817 10:45939370-45939392 CCAGAGACTGTGAGTCACCAAGG + Intergenic
1067866137 10:49908464-49908486 CCAGAGACTGTGAGTCACCAAGG + Intronic
1076009322 10:126974689-126974711 CCGAACTCTGTCATGCAGCAGGG + Intronic
1076120282 10:127931173-127931195 CTGGACACTGTGAGTCACTAGGG - Intronic
1077274132 11:1695533-1695555 CAGCACACTGTGAGGCACCAAGG - Intergenic
1084269148 11:68019862-68019884 CCTAACTCTGGGAGTCCACAGGG + Intronic
1090175010 11:124640912-124640934 CAGACCTCTGTGGGTCAGCAGGG - Intronic
1091220921 11:133929645-133929667 CGGACCTCTGTGAGTCACCCCGG - Intronic
1092520930 12:9272035-9272057 CAGACCTCTGTTAGTCAGCAGGG - Intergenic
1092553544 12:9529936-9529958 CCAAACCCTGTGAGTCTTCAAGG + Intergenic
1104669235 12:130669030-130669052 CCGAACTCACTGAGTCACTCTGG + Intronic
1104855983 12:131902748-131902770 CACAACTGTGTGTGTCACCACGG + Intronic
1106571136 13:30929115-30929137 TCAAACTCTGTGAATCACCTGGG + Intergenic
1109932621 13:69235322-69235344 CAGAACTCTGTGTGCCAGCACGG - Intergenic
1114917557 14:27287102-27287124 CTGTACTCTGTGACTCATCATGG + Intergenic
1122687707 14:103517944-103517966 CCCCACTCTGAGAGTCAACATGG + Intergenic
1126186146 15:45832135-45832157 GTGAACTCAGTGAATCACCACGG + Intergenic
1128578832 15:68794618-68794640 CCAAACTGTCTGAGACACCAAGG + Intronic
1131360917 15:91789634-91789656 CATCCCTCTGTGAGTCACCAAGG - Intergenic
1133460076 16:5979915-5979937 CCTACCTGTGTGAGTGACCATGG - Intergenic
1138413652 16:56858855-56858877 CCGAAGTCTGTGAGTAGTCAAGG + Intergenic
1138795736 16:59966380-59966402 CCAAACTGTGAGAGTCAACATGG + Intergenic
1144530361 17:16032784-16032806 CCTGACTCTGTGATTCTCCATGG - Intronic
1153834692 18:8953390-8953412 CTTCACTCTGTGAGTCACGAAGG - Intergenic
1156693706 18:39740271-39740293 CTGAAATCAGTGTGTCACCAGGG + Intergenic
1158023948 18:52873604-52873626 TAGAACGCTGTGATTCACCAAGG + Intronic
1161051999 19:2169032-2169054 CCACAGCCTGTGAGTCACCAGGG - Intronic
1163116610 19:15192428-15192450 CTGAACTCTGGCAGACACCACGG + Exonic
1163633447 19:18428178-18428200 CCTTACTCTGTGAGTGACCCTGG - Intronic
1164746841 19:30622714-30622736 CCCAGCTTTGGGAGTCACCAGGG + Intronic
1165657497 19:37547267-37547289 CCCAACACTTTGAGACACCAAGG + Intronic
1166916882 19:46201541-46201563 CCTGACTCTCTGAGTCATCAAGG + Intergenic
1167881452 19:52462194-52462216 CCGAACTCTGTGAATGAGCCAGG + Intronic
932611045 2:73200501-73200523 CTGAACTCTGTGAGTCATCAGGG - Intergenic
934673388 2:96231409-96231431 CCCAACACTGTGAGTGGCCAAGG - Intergenic
934913302 2:98278295-98278317 CAGAACTCTGTGTGGCCCCAAGG + Intronic
935223934 2:101037448-101037470 CCCAGCTGTCTGAGTCACCATGG - Intronic
936968526 2:118151484-118151506 CCCAACTCTATTTGTCACCAAGG - Intergenic
942160516 2:173181132-173181154 CCCAACTTTGTTAGTCACTAGGG + Intronic
947256622 2:228172791-228172813 CTGAAATCTGTTAGTCACCATGG + Intronic
1171018865 20:21565977-21565999 CCCAACCCTGTTAGTAACCAAGG - Intergenic
1175126256 20:56754084-56754106 CTGAACACAGTGGGTCACCAAGG - Intergenic
1180226050 21:46393149-46393171 CCGCACTCTGTGTGTCCACAGGG + Intronic
1183631074 22:39032951-39032973 CCGAAAGGCGTGAGTCACCAGGG - Exonic
1185202561 22:49517121-49517143 CTGAACCCTGTGGGTCAGCAGGG - Intronic
964091868 3:152886899-152886921 CAGAAGCCTGTCAGTCACCAGGG + Intergenic
969250682 4:5966533-5966555 ACCAACTCTCTGAGTAACCACGG + Intronic
985711545 5:1432360-1432382 CCGCACCCTGGGAGTCAGCAAGG + Intronic
986720491 5:10557606-10557628 CCAAACTGTGTGATTCACCACGG + Intergenic
987256185 5:16154235-16154257 CAGAATTCTGTGAGTTCCCAAGG - Intronic
997615985 5:135246486-135246508 CTGAACTCTGTAAGACATCACGG + Intronic
1002495641 5:179609556-179609578 CCAAACCCTGTGGGTCTCCAGGG + Exonic
1012233852 6:96790223-96790245 CTGCTCTCTGTGAGCCACCATGG + Intergenic
1014039031 6:116802711-116802733 GCTAACTGTGTGAATCACCACGG + Intronic
1015831425 6:137373470-137373492 CTGCACTCTGTGACTCATCACGG - Intergenic
1026347959 7:69491343-69491365 ATTAACTCTTTGAGTCACCATGG + Intergenic
1026458388 7:70592732-70592754 AAGCACTCTGTGGGTCACCATGG - Intronic
1026902419 7:74044531-74044553 CCAAAAGCTGTGAGTCACCAAGG + Intronic
1028614645 7:92752388-92752410 CAGAACTCTGAGAGTAAACAGGG + Intronic
1032360311 7:131249237-131249259 CCCAATTTTGTTAGTCACCAGGG - Intronic
1032906877 7:136378318-136378340 CCGGATTCTTTGAGTTACCAAGG - Intergenic
1035477452 7:159153280-159153302 TCGAACTGTGTGAGACACCAGGG + Intergenic
1036533968 8:9627114-9627136 CCAAACTCTGTGAGTCTTCATGG - Intronic
1040022536 8:42753825-42753847 CCTGACTCCGTGGGTCACCAGGG + Intronic
1040667822 8:49654041-49654063 CTGTCCTCTCTGAGTCACCAAGG + Intergenic
1045807562 8:106182719-106182741 ATAATCTCTGTGAGTCACCAAGG - Intergenic
1048294468 8:133204279-133204301 CCGCATTCTGTGATTCATCAGGG - Intronic
1055408044 9:75995300-75995322 AGGAACTGTGTGAGTCACTAAGG - Intronic
1056375792 9:86009909-86009931 CCGAACACAGTGAGTAACAAAGG - Exonic
1057132511 9:92664107-92664129 CCGGGGTCTGTCAGTCACCAGGG + Intronic
1060144749 9:121242409-121242431 CCGAACTCTGTGAGTCACCAAGG - Intronic
1061682652 9:132250567-132250589 CCGACCTCTGGGTGTCAACACGG + Intergenic
1186399706 X:9246218-9246240 CCCAACACTTTGGGTCACCAAGG + Intergenic
1189995266 X:46631643-46631665 ACCAACTCTGAAAGTCACCAGGG + Exonic
1195300052 X:103520483-103520505 CCGCAGTCACTGAGTCACCATGG + Intergenic