ID: 1060144757

View in Genome Browser
Species Human (GRCh38)
Location 9:121242438-121242460
Sequence CTGCTGTCCTCTGGAAAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060144748_1060144757 16 Left 1060144748 9:121242399-121242421 CCTCATTTAACCTTGGTGACTCA 0: 1
1: 0
2: 1
3: 15
4: 173
Right 1060144757 9:121242438-121242460 CTGCTGTCCTCTGGAAAAAGGGG No data
1060144749_1060144757 6 Left 1060144749 9:121242409-121242431 CCTTGGTGACTCACAGAGTTCGG 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1060144757 9:121242438-121242460 CTGCTGTCCTCTGGAAAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060144757 Original CRISPR CTGCTGTCCTCTGGAAAAAG GGG Intronic
No off target data available for this crispr