ID: 1060151725

View in Genome Browser
Species Human (GRCh38)
Location 9:121293121-121293143
Sequence CATTGTCCCCATCGGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060151721_1060151725 2 Left 1060151721 9:121293096-121293118 CCATCATCTGATGTGCTGCATCA 0: 1
1: 0
2: 0
3: 9
4: 128
Right 1060151725 9:121293121-121293143 CATTGTCCCCATCGGGAAGGTGG No data
1060151720_1060151725 25 Left 1060151720 9:121293073-121293095 CCAGCAGCAGGAGGGATGTGGCA 0: 1
1: 0
2: 2
3: 25
4: 339
Right 1060151725 9:121293121-121293143 CATTGTCCCCATCGGGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060151725 Original CRISPR CATTGTCCCCATCGGGAAGG TGG Intronic
No off target data available for this crispr