ID: 1060151966

View in Genome Browser
Species Human (GRCh38)
Location 9:121294525-121294547
Sequence GCACTAGGTGGGGCTGGCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060151950_1060151966 6 Left 1060151950 9:121294496-121294518 CCCCTCCAGATGTCCAGCCCTGG No data
Right 1060151966 9:121294525-121294547 GCACTAGGTGGGGCTGGCTCCGG No data
1060151956_1060151966 -7 Left 1060151956 9:121294509-121294531 CCAGCCCTGGGTCCCAGCACTAG No data
Right 1060151966 9:121294525-121294547 GCACTAGGTGGGGCTGGCTCCGG No data
1060151952_1060151966 5 Left 1060151952 9:121294497-121294519 CCCTCCAGATGTCCAGCCCTGGG No data
Right 1060151966 9:121294525-121294547 GCACTAGGTGGGGCTGGCTCCGG No data
1060151954_1060151966 4 Left 1060151954 9:121294498-121294520 CCTCCAGATGTCCAGCCCTGGGT No data
Right 1060151966 9:121294525-121294547 GCACTAGGTGGGGCTGGCTCCGG No data
1060151955_1060151966 1 Left 1060151955 9:121294501-121294523 CCAGATGTCCAGCCCTGGGTCCC No data
Right 1060151966 9:121294525-121294547 GCACTAGGTGGGGCTGGCTCCGG No data
1060151949_1060151966 11 Left 1060151949 9:121294491-121294513 CCAGGCCCCTCCAGATGTCCAGC No data
Right 1060151966 9:121294525-121294547 GCACTAGGTGGGGCTGGCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060151966 Original CRISPR GCACTAGGTGGGGCTGGCTC CGG Intronic