ID: 1060152393 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:121296947-121296969 |
Sequence | GTTGATGGCCAGTGGCCTCT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1060152385_1060152393 | 5 | Left | 1060152385 | 9:121296919-121296941 | CCTTTGTGATCATTAACGTGGTC | 0: 1 1: 0 2: 0 3: 0 4: 62 |
||
Right | 1060152393 | 9:121296947-121296969 | GTTGATGGCCAGTGGCCTCTGGG | No data | ||||
1060152384_1060152393 | 6 | Left | 1060152384 | 9:121296918-121296940 | CCCTTTGTGATCATTAACGTGGT | 0: 1 1: 0 2: 1 3: 6 4: 82 |
||
Right | 1060152393 | 9:121296947-121296969 | GTTGATGGCCAGTGGCCTCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1060152393 | Original CRISPR | GTTGATGGCCAGTGGCCTCT GGG | Intronic | ||
No off target data available for this crispr |