ID: 1060152393

View in Genome Browser
Species Human (GRCh38)
Location 9:121296947-121296969
Sequence GTTGATGGCCAGTGGCCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060152385_1060152393 5 Left 1060152385 9:121296919-121296941 CCTTTGTGATCATTAACGTGGTC 0: 1
1: 0
2: 0
3: 0
4: 62
Right 1060152393 9:121296947-121296969 GTTGATGGCCAGTGGCCTCTGGG No data
1060152384_1060152393 6 Left 1060152384 9:121296918-121296940 CCCTTTGTGATCATTAACGTGGT 0: 1
1: 0
2: 1
3: 6
4: 82
Right 1060152393 9:121296947-121296969 GTTGATGGCCAGTGGCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060152393 Original CRISPR GTTGATGGCCAGTGGCCTCT GGG Intronic
No off target data available for this crispr