ID: 1060153887

View in Genome Browser
Species Human (GRCh38)
Location 9:121305739-121305761
Sequence GCGCTGGCTCCTGGTGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060153880_1060153887 14 Left 1060153880 9:121305702-121305724 CCAGCTGGGCCCAGATTTGGGGC 0: 1
1: 0
2: 1
3: 20
4: 199
Right 1060153887 9:121305739-121305761 GCGCTGGCTCCTGGTGTGAATGG No data
1060153882_1060153887 4 Left 1060153882 9:121305712-121305734 CCAGATTTGGGGCTTCTGTCCTG 0: 1
1: 0
2: 1
3: 22
4: 238
Right 1060153887 9:121305739-121305761 GCGCTGGCTCCTGGTGTGAATGG No data
1060153881_1060153887 5 Left 1060153881 9:121305711-121305733 CCCAGATTTGGGGCTTCTGTCCT 0: 1
1: 0
2: 11
3: 76
4: 690
Right 1060153887 9:121305739-121305761 GCGCTGGCTCCTGGTGTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060153887 Original CRISPR GCGCTGGCTCCTGGTGTGAA TGG Intronic
No off target data available for this crispr