ID: 1060154662

View in Genome Browser
Species Human (GRCh38)
Location 9:121310924-121310946
Sequence ACAAATGCATAGATGCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 230}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060154653_1060154662 26 Left 1060154653 9:121310875-121310897 CCACTGAGGTGCTCCTGGTCTGA 0: 1
1: 0
2: 0
3: 9
4: 178
Right 1060154662 9:121310924-121310946 ACAAATGCATAGATGCAGGTGGG 0: 1
1: 0
2: 0
3: 16
4: 230
1060154657_1060154662 13 Left 1060154657 9:121310888-121310910 CCTGGTCTGATCAGGGACTTGGG 0: 1
1: 0
2: 2
3: 9
4: 177
Right 1060154662 9:121310924-121310946 ACAAATGCATAGATGCAGGTGGG 0: 1
1: 0
2: 0
3: 16
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060154662 Original CRISPR ACAAATGCATAGATGCAGGT GGG Intronic
900086694 1:901890-901912 ACACATGCCTACATGGAGGTAGG - Intergenic
900865902 1:5268426-5268448 TCGAATCCATAGGTGCAGGTGGG + Intergenic
901567720 1:10132465-10132487 AAGAAAGCACAGATGCAGGTAGG + Exonic
902599029 1:17528573-17528595 ACAAATGGATGGATGGAGGATGG - Intergenic
904638674 1:31904595-31904617 ACAGTAGCACAGATGCAGGTGGG + Intergenic
906065369 1:42976690-42976712 ACATCTGCATTGATGCAGGCAGG - Intergenic
907322581 1:53614632-53614654 AGAAAAGCGTAGATGCAGGGAGG + Intronic
909819846 1:80048400-80048422 AAAAATGTATAGATGTATGTGGG - Intergenic
910671100 1:89773650-89773672 AGAAATGCATATAATCAGGTAGG + Intronic
910734383 1:90436179-90436201 AGAAATCCAGAGATTCAGGTAGG + Intergenic
912616893 1:111110812-111110834 AAAAATGCATTGAAGAAGGTAGG - Intergenic
913254430 1:116941053-116941075 ACAAAGGGAGAGAGGCAGGTTGG - Intronic
915395771 1:155582854-155582876 ACAAAAACAAAGTTGCAGGTAGG - Intergenic
916459898 1:165012874-165012896 ACAAACTCATAGAGCCAGGTGGG - Intergenic
916506317 1:165431000-165431022 ACAAATGCTAAGATACAAGTAGG - Intronic
917887683 1:179402449-179402471 ATATAAGCACAGATGCAGGTGGG - Intronic
918742015 1:188143663-188143685 ACAAAAACAGAGATGCAGATAGG - Intergenic
918870098 1:189960677-189960699 CAAAAGCCATAGATGCAGGTAGG - Intergenic
918984334 1:191603764-191603786 ACAAATACATATATGTATGTGGG + Intergenic
920245144 1:204582268-204582290 CCAAAGGCATGGATGCAAGTGGG + Intergenic
920618390 1:207518927-207518949 ACAAATTCATAGTTGTAGTTGGG - Intronic
921151534 1:212406940-212406962 AGAAGTGCATAGATGGAGGCAGG - Intronic
921437759 1:215146547-215146569 ACAAATGCATTGATTAAAGTAGG - Intronic
922080400 1:222290346-222290368 ACAAAATCATAGAATCAGGTAGG + Intergenic
923427031 1:233881269-233881291 CTAAATGCAGAGATGGAGGTGGG - Intergenic
924088210 1:240476365-240476387 TCAAAAGTATAGATGCAGGGTGG + Intergenic
924578958 1:245306652-245306674 ACAAATGTATAGATGGTGGGGGG - Intronic
1063597256 10:7447186-7447208 ACAAATGGACAAAGGCAGGTAGG - Intergenic
1063902958 10:10753952-10753974 TCAAATGCATTGATGCAATTAGG + Intergenic
1065171947 10:23039726-23039748 ACAAATCCATACATATAGGTAGG + Intergenic
1066667403 10:37798679-37798701 ACACATATATACATGCAGGTAGG + Intronic
1067237584 10:44464266-44464288 TCAAATTCACAGATGCAGGAAGG - Intergenic
1070073753 10:73115107-73115129 ACAAATGAAGAGATGCATTTAGG - Intronic
1070210878 10:74319586-74319608 ACATATGCATAGTGGCAGGAGGG + Intronic
1070342446 10:75510380-75510402 AGAAAAGCATAGATGCTGTTGGG + Intronic
1071431553 10:85610914-85610936 ACACATGGAGAGAGGCAGGTTGG - Intronic
1071445143 10:85738857-85738879 TCAAATGCAAAGAGGAAGGTGGG + Intronic
1073215280 10:101832775-101832797 ACAGAGGCTTAGAAGCAGGTAGG - Intronic
1077904163 11:6516154-6516176 ACAAATCTATAGTTGTAGGTAGG - Intronic
1078713324 11:13816095-13816117 ACACAGGCATAGATGCAGATGGG + Intergenic
1079212280 11:18473363-18473385 ACTAATTGATAGATGAAGGTAGG + Intronic
1079425566 11:20338988-20339010 ACACATACATACATGCAGGCAGG - Intergenic
1079785030 11:24661097-24661119 ACCAATTCATATATGTAGGTGGG + Intronic
1080725117 11:34890705-34890727 ACAAAGGCATTGATGTAGTTTGG - Intronic
1084214914 11:67641938-67641960 CCAACTGCAGAGATGCAGGGAGG - Intergenic
1085184572 11:74564596-74564618 ACAAACACTTAGATGGAGGTAGG - Intronic
1088576749 11:111279581-111279603 ACAAAGACACAGATGCAGATGGG - Intronic
1088782800 11:113152309-113152331 AGAAATGCACAGATGCAGTATGG - Intronic
1090505236 11:127304737-127304759 ACAGGTGCAGTGATGCAGGTTGG + Intergenic
1090509810 11:127363147-127363169 AGAAAAGCATAGATGGAGGGAGG + Intergenic
1091057418 11:132431845-132431867 ACAAATGCATGCCTGCAGATGGG + Intronic
1091949425 12:4580653-4580675 ATAAATGCATTCATGCAGGGAGG - Intronic
1092853829 12:12654535-12654557 AAATATGCATAGATGATGGTTGG - Intergenic
1099209122 12:79763145-79763167 ACAACTGCAGAGGTGCTGGTGGG + Intergenic
1101634659 12:106528593-106528615 AGAAATGCAAAGATGGAGGTGGG + Intronic
1102208019 12:111103980-111104002 GCAAATGCATGGATCCAAGTTGG - Intronic
1102722624 12:115030827-115030849 ACACATGTATATATACAGGTAGG - Intergenic
1103129797 12:118458248-118458270 AAAAATTGATAGAAGCAGGTGGG + Intergenic
1107191665 13:37595622-37595644 ACAAATGCATAGATGTAGACAGG - Intronic
1108240004 13:48454392-48454414 ACAAATGTATACATGAAGGCAGG - Intronic
1108728354 13:53205243-53205265 ACAAAGGCCTAAATGAAGGTGGG - Intergenic
1108918787 13:55651797-55651819 AGAAATGAATAGAAGAAGGTTGG - Intergenic
1109209862 13:59522676-59522698 TCAAATACATAGAAGCAGGGTGG + Intergenic
1109495761 13:63169822-63169844 CCAAAAGCATAAATGCATGTGGG - Intergenic
1110158671 13:72350194-72350216 ACAGTTTCATAGATGCTGGTAGG - Intergenic
1114840387 14:26256230-26256252 ACAAATGCCTTGAGGCAGGAAGG - Intergenic
1114947806 14:27708204-27708226 ACAAATGCAAAGTTGCATGAAGG + Intergenic
1115617851 14:35113335-35113357 ACAAATCCATAGCTGCAGACAGG + Intronic
1117197689 14:53356637-53356659 ACAAACTCTTAGATGCAAGTTGG + Intergenic
1118900046 14:69979050-69979072 TCCAAGGCCTAGATGCAGGTGGG - Intronic
1120734726 14:88040281-88040303 ACATAGGAACAGATGCAGGTAGG - Intergenic
1122566072 14:102657261-102657283 CCAAAAGCATACATACAGGTGGG - Intronic
1123805873 15:23872645-23872667 ACAAATGCATGGTTGCAGGACGG - Intergenic
1124839388 15:33227793-33227815 ACAAATGCAAAGAAGCATGAGGG - Intergenic
1125250235 15:37693558-37693580 ATATATGCATACATGCAGGCAGG + Intergenic
1128221440 15:65971512-65971534 ACACAGGCACAGATGAAGGTGGG + Intronic
1129685472 15:77684016-77684038 ACAAAGGCCTAGAGGCAGCTTGG - Intronic
1130086643 15:80783249-80783271 AGAAATGCAAACATGTAGGTTGG + Intronic
1130360172 15:83176818-83176840 AAAAATGCATTGGTGCAAGTTGG + Intronic
1131766977 15:95688041-95688063 ACAGGTGCATAGATGGAGGCAGG - Intergenic
1132367378 15:101267348-101267370 GCAAAGGCGTAGATGCAGGGAGG - Intergenic
1133542364 16:6768631-6768653 ACTAATGAATATATACAGGTAGG - Intronic
1135535601 16:23291875-23291897 ATAAATGCAGAGACACAGGTTGG - Intronic
1138626644 16:58257311-58257333 AGAAATTCATATATGCAGGCTGG - Intronic
1140901776 16:79374404-79374426 ACAAAAGCAGAGATGAAGCTTGG - Intergenic
1141283390 16:82649300-82649322 ATGAATGCATAGATGGAGGATGG + Intronic
1141658507 16:85429143-85429165 ATACATGCAGAGGTGCAGGTGGG + Intergenic
1143037393 17:4007254-4007276 AACAGTGCAAAGATGCAGGTGGG + Intronic
1147196063 17:38767639-38767661 CCAAATGCAGAGAAGCCGGTAGG + Exonic
1147221674 17:38936856-38936878 AAAAATGCATACATACAGGTTGG + Exonic
1149554715 17:57565163-57565185 AAAAATCCTTAGATGCAGATGGG - Intronic
1150858125 17:68772783-68772805 ACAAGTCCCTAGAGGCAGGTGGG + Intergenic
1153383416 18:4464689-4464711 ACATATGTATAGATACAGGTGGG + Intergenic
1153704981 18:7736225-7736247 ACAACTGCTTAGCTCCAGGTAGG + Intronic
1154015393 18:10611931-10611953 ACATACACATAGAGGCAGGTAGG + Intergenic
1154024637 18:10696026-10696048 ACAGTTGCATGGAGGCAGGTTGG + Intronic
1157283928 18:46364298-46364320 AAAAGTGCATAGGTGGAGGTGGG - Intronic
1157893912 18:51446211-51446233 ACAAATGCTTATTTGCAGATCGG - Intergenic
1157952229 18:52052589-52052611 TCAAGTGCAGAGATGAAGGTAGG + Intergenic
1159028885 18:63210997-63211019 ACAAATGGACAGATTCAGGGCGG - Intronic
1162314469 19:9929624-9929646 ATAAATGAATACATGCATGTAGG + Intronic
1162752918 19:12839722-12839744 ACAAAGACATAGATACATGTAGG + Intronic
1165798838 19:38535375-38535397 ACTGATGCAAACATGCAGGTAGG + Exonic
1166799429 19:45447053-45447075 ACACTTGCTTAGAGGCAGGTTGG + Intronic
1167150947 19:47709306-47709328 ATGAATGCATTGAGGCAGGTTGG - Intergenic
1168502568 19:56905821-56905843 AGGAATGCATAGATCCAGGGGGG - Intergenic
925068478 2:948930-948952 ACAGATGCATAAAAGCAGATAGG + Intergenic
926917053 2:17902157-17902179 ACAGATGCAGATATGCAGATTGG + Intronic
929788319 2:45007341-45007363 TCAAAGGCATAGAAGGAGGTGGG - Intronic
930302139 2:49629870-49629892 ACAAAGACATAGTTGCAGATTGG + Intergenic
930401327 2:50893171-50893193 ACAAATGCTCAGATGCACTTAGG - Intronic
930841777 2:55855348-55855370 AAAAATGAATATATGCAAGTGGG + Intergenic
932965691 2:76472375-76472397 AGAAATCAATAGATGCAAGTGGG - Intergenic
933299246 2:80524051-80524073 ACAAAAGCATAGCTGCTGATGGG + Intronic
934991855 2:98927196-98927218 ACTAATGCAGAGCAGCAGGTGGG + Intronic
935405138 2:102700897-102700919 ACATATACATATATACAGGTAGG + Intronic
936003738 2:108862831-108862853 ACAGTTGCATATTTGCAGGTAGG + Intronic
937591944 2:123624911-123624933 AAAAAAGGATAGATGCTGGTTGG + Intergenic
937721985 2:125109944-125109966 ACAAATGTAAAGATACATGTTGG + Intergenic
938883181 2:135613519-135613541 ACAAATGCATAAATCCAGCAGGG + Intronic
939152298 2:138487318-138487340 ACAGATGCAGAGATACAGGTAGG - Intergenic
939244054 2:139599917-139599939 ACAAATGCCTAGATGGAATTAGG - Intergenic
939600707 2:144186494-144186516 ACTAATACATAGATGTATGTGGG + Intronic
940004102 2:148995859-148995881 AAAAATGAATGGATGCAGCTGGG + Intronic
940247800 2:151638129-151638151 CCAAACGCATAAATGCAGGATGG + Intronic
940769746 2:157827257-157827279 AGAAATGCCTACATGCTGGTGGG - Intronic
944894245 2:204147678-204147700 TCAAACGCATAGAAGCAGGGAGG - Intergenic
945821757 2:214673535-214673557 ACAAAGTCATGGAAGCAGGTAGG + Intergenic
945829170 2:214762488-214762510 ACAAATGGAGACATGCAGCTTGG + Intronic
947865181 2:233392439-233392461 ACAAATGCATACATACCAGTGGG - Intronic
1168731369 20:84385-84407 AAAAATGCATAGCAGCATGTGGG - Intergenic
1177780338 21:25615421-25615443 ACAAACGCAAAGATGCATGAAGG - Intergenic
1179289016 21:40002392-40002414 ACACATGCATATATGCTGTTGGG + Intergenic
1179635839 21:42708433-42708455 ACAAATGCCTAGGAGCAGGGAGG - Intronic
1180887500 22:19257616-19257638 ACATCTGCATAGATGCCGGCTGG - Intronic
1184180430 22:42819948-42819970 ACAAAAACAAAGATGCAGATCGG - Intronic
949917797 3:8977991-8978013 CCAAATGCCTAGCTGCAGGGAGG - Intergenic
950147700 3:10663676-10663698 ACAAAAGCAGAGCTGCAGGAGGG + Intronic
950453770 3:13080423-13080445 ACACAGGCAGAGATGCAGGGTGG + Intergenic
950631035 3:14282123-14282145 ACAGATGCAAAGATGCGGGGTGG + Intergenic
951398532 3:22201725-22201747 TAAAATGCATACATGCAGGAAGG + Intronic
952546397 3:34424434-34424456 AGGAGTGCATAAATGCAGGTAGG - Intergenic
952720880 3:36531484-36531506 ACAAATGGAGAGATGCAGACAGG + Intronic
954438528 3:50508921-50508943 ACAAATGAATGGCTGGAGGTGGG + Intergenic
954593429 3:51803905-51803927 TCATATGCATAGATGCATGAGGG + Intergenic
956514130 3:70027646-70027668 ATAAATGCATAGATCCACCTTGG - Intergenic
959926940 3:111932826-111932848 ACAAAAGAATAGCTGCTGGTGGG - Intronic
961477136 3:127154086-127154108 ACAAATGCATACACACAGCTTGG - Intergenic
962273655 3:133996359-133996381 ACAGATGCTTAGAAGCAGGGCGG + Intronic
962604922 3:137025139-137025161 CCAAAAGCATGGATGCAGGAGGG + Intergenic
964465801 3:156990599-156990621 ATAAATAAATAGATGAAGGTAGG - Intronic
964924681 3:161940834-161940856 AGAAAAGCATAAATGCAGGCAGG + Intergenic
965206476 3:165724582-165724604 ATAAATGCATAGTTTTAGGTGGG - Intergenic
965872530 3:173278811-173278833 ACCAATGCTCAGAGGCAGGTAGG - Intergenic
966055617 3:175685221-175685243 AGACCTGCATAGATGGAGGTGGG - Intronic
966238061 3:177724896-177724918 ACAAATACATACATGGAGGAAGG - Intergenic
966730164 3:183144362-183144384 ACAAGTGCATTGATGAAGTTTGG + Intronic
968687373 4:1970370-1970392 ACAGCTACAGAGATGCAGGTTGG + Intronic
970356509 4:15258986-15259008 ACAAATGCATGAAGGCAGGAAGG - Intergenic
972224172 4:36993109-36993131 AGAAATGCATAGATTCATGCAGG - Intergenic
972921051 4:43942205-43942227 ACAAAAGAATAGATGCTGGTGGG - Intergenic
974207300 4:58721887-58721909 ACATATGCATATATACATGTGGG - Intergenic
974382521 4:61159804-61159826 CCAAATGCCTACATGCAGCTAGG - Intergenic
974893980 4:67916004-67916026 ACAAATTCATATTTGCAGTTAGG - Intronic
976416665 4:84784233-84784255 ACCAAAGCATAGATGTAGATAGG - Intronic
977326262 4:95578670-95578692 TCAAATGCACAGATGCACATAGG - Intergenic
978087374 4:104669966-104669988 ACAAGTGCATGAATGCAGGTAGG - Intergenic
980734033 4:136859757-136859779 ACAAAGACAGAGATGTAGGTTGG + Intergenic
981457161 4:144966159-144966181 ACATGTGCAGATATGCAGGTTGG - Intergenic
983265989 4:165508549-165508571 AGAAATGCAAAGATGCCGCTGGG + Intergenic
987192021 5:15488159-15488181 ACAAATGAATGCATGCAGGAGGG + Intergenic
988231663 5:28487559-28487581 ACCAAAGCATTGCTGCAGGTGGG + Intergenic
988850502 5:35175676-35175698 AAAAATGCATAGAGCAAGGTGGG - Intronic
989422679 5:41257873-41257895 TCAAATACATACATGTAGGTGGG - Intronic
992849461 5:80791819-80791841 ATAAATGCACAGAAGAAGGTTGG + Intronic
993121351 5:83778471-83778493 TCAAGTGAATAGATACAGGTGGG + Intergenic
994251880 5:97545211-97545233 ACAAATTCAGAGATGCTGGGAGG + Intergenic
994525987 5:100904858-100904880 AGAAATGCATTAATGCAGGCTGG - Intergenic
995401376 5:111745909-111745931 ACAAATGGAAAGATGCAGATGGG + Intronic
995987605 5:118198358-118198380 GCAAATGCATAAATCCTGGTAGG + Intergenic
999468095 5:151826051-151826073 TCAAATGCATAGAAGGAGGCAGG + Intronic
999560964 5:152802412-152802434 AGAAATGCATAGAGGCACCTTGG + Intergenic
1000488190 5:161875089-161875111 CCAAATGCATAGAAGAAGGTAGG - Intronic
1003223561 6:4184295-4184317 AGAAATGAAAAAATGCAGGTAGG - Intergenic
1003353231 6:5340640-5340662 ATAAATGCAAAGATGGAAGTAGG + Intronic
1003425036 6:5993524-5993546 ACACATACATATATGGAGGTTGG - Intergenic
1003485382 6:6571548-6571570 ACAAATTCATAGAGACAGGATGG - Intergenic
1003728766 6:8796339-8796361 ACAAATGCGCAGAAGAAGGTGGG + Intergenic
1003748411 6:9027896-9027918 ACCAATGCACAGATCCAGGAAGG + Intergenic
1005070692 6:21859770-21859792 ACAACTCCATAGATGGTGGTTGG + Intergenic
1006596771 6:35199333-35199355 ACAAAGGCATTGTTGCAGTTTGG - Intergenic
1006929057 6:37676545-37676567 ACATAAGCATGGATGGAGGTAGG + Intronic
1007805688 6:44444098-44444120 CCAGATGCATAGATGTAGCTGGG + Intronic
1013372798 6:109484439-109484461 ATAAATGGATGGAAGCAGGTGGG - Intergenic
1013727637 6:113119197-113119219 TCAAAGGTACAGATGCAGGTTGG - Intergenic
1015184006 6:130392620-130392642 ACAAAGGCATAGAAGCATGTTGG - Intronic
1015787902 6:136936814-136936836 ACAAATGCAGAGGAGCAGGAAGG + Intergenic
1018475638 6:164138162-164138184 AGGAATGCAGAGAAGCAGGTGGG - Intergenic
1018778195 6:167038156-167038178 ACAAATGAATAGATATAAGTTGG + Intronic
1020553262 7:9635201-9635223 ACAACTGCACAGATGAAGTTTGG - Intergenic
1021338798 7:19437804-19437826 ACAAATGTACAAATGCAGGATGG - Intergenic
1022321157 7:29289090-29289112 ACAAATGCGTTGGTGCGGGTTGG - Intronic
1023447221 7:40244338-40244360 ACAAATGCAGAGAAGCAGGAAGG + Intronic
1024835853 7:53517677-53517699 ACAAATGCATAGATTAAGATTGG - Intergenic
1026157451 7:67839350-67839372 AAAAATGCATATATCCAGGCTGG - Intergenic
1026871358 7:73854317-73854339 AAAAAAGCATAAATGCAGGCCGG - Intergenic
1028838999 7:95406314-95406336 TCACATGCATAGAGGCAGGAAGG - Intronic
1030959928 7:115905622-115905644 ACAACTAAATAGATGGAGGTGGG - Intergenic
1030975831 7:116121988-116122010 ACAAATGTATAGCTGTAGCTAGG + Intronic
1032519407 7:132532402-132532424 ACAAATGCGTTGATGCAGTTGGG + Intronic
1033052818 7:138021772-138021794 ACTAATGCAAAGATGCAATTTGG + Intronic
1034151927 7:148923517-148923539 AGAAATGCATAGAAGAAGGGAGG - Intergenic
1037823680 8:22148043-22148065 ACAAGGGCATGAATGCAGGTTGG + Exonic
1038138656 8:24818741-24818763 ACAAAGGCAGAGATTCAGGGTGG - Intergenic
1038207024 8:25476468-25476490 ACACATACAGAGATGCAGGAGGG - Intronic
1039646474 8:39289996-39290018 CCAAATGCATACATACAGGTGGG + Intergenic
1040639624 8:49318266-49318288 ACACATGCATAGAAACATGTAGG + Intergenic
1044494707 8:92862927-92862949 ACTAATTAATGGATGCAGGTAGG - Intergenic
1045660503 8:104432626-104432648 GCAAATACATAGAAGCAGCTTGG + Intronic
1046480895 8:114816562-114816584 ACAAATGCAATGGTGGAGGTTGG - Intergenic
1047428544 8:124768938-124768960 ATAAATGGATAGATGTAGCTGGG + Intergenic
1047451545 8:124969509-124969531 ACATATGTATATAAGCAGGTAGG + Intergenic
1047748273 8:127861310-127861332 ACAAAAGCATGGGTGCAGGCTGG + Intergenic
1047991196 8:130288466-130288488 GTAAATGCACAGCTGCAGGTAGG - Intronic
1049152556 8:141044678-141044700 GCACATGTATAGGTGCAGGTGGG - Intergenic
1050278207 9:4022415-4022437 ATAAATGGATAGAACCAGGTTGG - Intronic
1051198968 9:14596618-14596640 ACAAATGCCTGGATTCAGATAGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1056398934 9:86208474-86208496 ACAAATGCATTTCTGCAGTTGGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056851125 9:90085300-90085322 ACAAATGCATGGATTCACTTTGG - Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1059860743 9:118458383-118458405 AAAAATAAATAGATGCAGATAGG + Intergenic
1060154662 9:121310924-121310946 ACAAATGCATAGATGCAGGTGGG + Intronic
1185940104 X:4308297-4308319 ATAAGTACATAGATTCAGGTTGG - Intergenic
1186101193 X:6158314-6158336 ACAAAAGCATGGAAGCAGTTTGG - Intronic
1186474014 X:9843048-9843070 ACAAATGCAAACATCCTGGTTGG - Intronic
1187708376 X:22029720-22029742 ACAAATGGATAGATGGGGGATGG - Intergenic
1188656827 X:32707433-32707455 GCAAATGCACAGAAGCTGGTGGG + Intronic
1190117046 X:47632492-47632514 GCAAATACATAGTAGCAGGTAGG - Intergenic
1193116842 X:77783851-77783873 AGAACTGCATATATGCATGTAGG - Intronic
1196216311 X:113056080-113056102 AAAAATGCAGAGATGAATGTAGG + Intergenic
1196816730 X:119670996-119671018 ACACATGCACACATGCATGTAGG + Intronic
1197959154 X:131985426-131985448 ACAAAGGCAAAGAGGCAGGAAGG - Intergenic
1199137102 X:144266268-144266290 ACACATGAACAGTTGCAGGTGGG + Intergenic