ID: 1060155091

View in Genome Browser
Species Human (GRCh38)
Location 9:121313966-121313988
Sequence TACCGAGGACACCGCCAAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 41}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060155086_1060155091 -1 Left 1060155086 9:121313944-121313966 CCAAGCCGGCTCTGCCTGCAGGT 0: 1
1: 1
2: 4
3: 25
4: 259
Right 1060155091 9:121313966-121313988 TACCGAGGACACCGCCAAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 41
1060155083_1060155091 1 Left 1060155083 9:121313942-121313964 CCCCAAGCCGGCTCTGCCTGCAG 0: 1
1: 0
2: 1
3: 33
4: 242
Right 1060155091 9:121313966-121313988 TACCGAGGACACCGCCAAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 41
1060155078_1060155091 30 Left 1060155078 9:121313913-121313935 CCATCTCTCTATCTCCTACAGGT 0: 1
1: 0
2: 2
3: 64
4: 373
Right 1060155091 9:121313966-121313988 TACCGAGGACACCGCCAAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 41
1060155084_1060155091 0 Left 1060155084 9:121313943-121313965 CCCAAGCCGGCTCTGCCTGCAGG 0: 1
1: 0
2: 6
3: 15
4: 231
Right 1060155091 9:121313966-121313988 TACCGAGGACACCGCCAAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 41
1060155081_1060155091 16 Left 1060155081 9:121313927-121313949 CCTACAGGTGCTGGGCCCCAAGC 0: 1
1: 0
2: 4
3: 19
4: 239
Right 1060155091 9:121313966-121313988 TACCGAGGACACCGCCAAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 41
1060155087_1060155091 -6 Left 1060155087 9:121313949-121313971 CCGGCTCTGCCTGCAGGTACCGA 0: 1
1: 0
2: 1
3: 15
4: 170
Right 1060155091 9:121313966-121313988 TACCGAGGACACCGCCAAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060155091 Original CRISPR TACCGAGGACACCGCCAAGG AGG Exonic
900596875 1:3483977-3483999 TGCAGAGGACACCGCCAGGGTGG - Intergenic
905110067 1:35588529-35588551 TGCGGAGGACACCCCCCAGGAGG - Exonic
919946468 1:202322749-202322771 CACCTAGGGCACAGCCAAGGAGG + Intergenic
1063531803 10:6840266-6840288 TACCAAGGACAGAGCCAAGGAGG - Intergenic
1064557417 10:16561471-16561493 TAGTGAGGACAGCACCAAGGGGG - Intergenic
1069941911 10:71962479-71962501 TGCAGAGGAGACAGCCAAGGCGG + Intergenic
1076739523 10:132476458-132476480 TTCCCAGGACACAGCCCAGGTGG - Intergenic
1090893404 11:130947908-130947930 TACCTAAGAGACTGCCAAGGAGG - Intergenic
1092395046 12:8118640-8118662 TGGCGAGGACACTACCAAGGGGG + Intergenic
1095931660 12:47632308-47632330 TGGTGAGGACACCACCAAGGGGG + Intergenic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1102896113 12:116599785-116599807 TAACAAGGACACCGGGAAGGTGG - Intergenic
1130520298 15:84656776-84656798 TACACAGGACACAGCAAAGGTGG + Intronic
1137851702 16:51752205-51752227 CACCAAGGACTCCGCCTAGGAGG - Intergenic
1141393872 16:83687492-83687514 TCCCGAAGACGCCACCAAGGAGG + Intronic
1141588259 16:85049525-85049547 TCTCGAGGACAGTGCCAAGGGGG - Intronic
1142357447 16:89608713-89608735 TACTGAGGACACAGACGAGGTGG - Intergenic
1148323553 17:46771248-46771270 GACCGAGGACGGCGGCAAGGGGG + Intronic
1148561789 17:48610597-48610619 TCCCGGCGACTCCGCCAAGGCGG - Exonic
1150524911 17:65912407-65912429 TACAGAGGAAACCACCATGGAGG + Intronic
1151369043 17:73635912-73635934 TAGTGAGGACACAGCCAGGGTGG + Intronic
1153006028 18:499810-499832 TGCAGAGGACACCGCGCAGGGGG + Intronic
1160575021 18:79848441-79848463 GGCCGAGGTCACAGCCAAGGAGG - Intergenic
1162217417 19:9147946-9147968 TCACGAGGACAGTGCCAAGGGGG - Intronic
1162796783 19:13091223-13091245 GGCTGAGGACACCTCCAAGGTGG - Intronic
1164698251 19:30262847-30262869 TTCTGAGGACGCCTCCAAGGAGG + Intronic
934734318 2:96681401-96681423 TACCTGGGACACTGCCAAGCAGG - Intergenic
934734459 2:96682647-96682669 TACCTGGGACACTGCCAAGCAGG + Intergenic
1170684336 20:18555439-18555461 GACGGAGGACACCACCATGGAGG - Intronic
1175707877 20:61194580-61194602 TGCCGAGGACACGGGCCAGGTGG + Intergenic
951737210 3:25881056-25881078 TACCAAGAAGACCCCCAAGGGGG - Intergenic
953568079 3:44050365-44050387 TACAAAGGACAGAGCCAAGGAGG + Intergenic
968658104 4:1787258-1787280 TCCCGAGGAAGCCGCCCAGGGGG + Intergenic
969056485 4:4405869-4405891 TTCGGAGGACACCCCCGAGGAGG + Intronic
980594454 4:134935051-134935073 TAAAGAGGACATCACCAAGGTGG + Intergenic
999107595 5:149087289-149087311 TAACAAGGACAGCACCAAGGGGG - Intergenic
1007397793 6:41587360-41587382 TGCCGAGGACAGCGTCAAGCAGG + Exonic
1036564295 8:9925156-9925178 TACCGAAGACAGCGCCCAGAGGG + Intergenic
1043772787 8:84225722-84225744 TAAAGAGGACACCGTGAAGGTGG - Intronic
1060155091 9:121313966-121313988 TACCGAGGACACCGCCAAGGAGG + Exonic
1061406319 9:130394716-130394738 TCCCAAGGGCACGGCCAAGGTGG - Intronic
1062314954 9:135962358-135962380 TACAGAGACCACTGCCAAGGGGG - Intergenic
1062503969 9:136863395-136863417 TACCAAGAACACGGCCAAGCTGG - Exonic
1197679072 X:129363085-129363107 TACTGAGGACACTGTCAAAGAGG - Intergenic