ID: 1060155097

View in Genome Browser
Species Human (GRCh38)
Location 9:121313995-121314017
Sequence GAGCTTGGCCAGCTTGCGGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 127}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060155097_1060155105 18 Left 1060155097 9:121313995-121314017 CCAACCGCAAGCTGGCCAAGCTC 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1060155105 9:121314036-121314058 TGCACTGTCTGCCTGGGCATGGG 0: 1
1: 0
2: 2
3: 26
4: 254
1060155097_1060155106 19 Left 1060155097 9:121313995-121314017 CCAACCGCAAGCTGGCCAAGCTC 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1060155106 9:121314037-121314059 GCACTGTCTGCCTGGGCATGGGG 0: 1
1: 0
2: 0
3: 20
4: 283
1060155097_1060155104 17 Left 1060155097 9:121313995-121314017 CCAACCGCAAGCTGGCCAAGCTC 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1060155104 9:121314035-121314057 ATGCACTGTCTGCCTGGGCATGG 0: 1
1: 1
2: 5
3: 18
4: 277
1060155097_1060155109 29 Left 1060155097 9:121313995-121314017 CCAACCGCAAGCTGGCCAAGCTC 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1060155109 9:121314047-121314069 CCTGGGCATGGGGTCAGGACAGG 0: 1
1: 1
2: 4
3: 54
4: 458
1060155097_1060155101 11 Left 1060155097 9:121313995-121314017 CCAACCGCAAGCTGGCCAAGCTC 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1060155101 9:121314029-121314051 CACCAGATGCACTGTCTGCCTGG 0: 1
1: 0
2: 1
3: 15
4: 211
1060155097_1060155102 12 Left 1060155097 9:121313995-121314017 CCAACCGCAAGCTGGCCAAGCTC 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1060155102 9:121314030-121314052 ACCAGATGCACTGTCTGCCTGGG 0: 1
1: 0
2: 1
3: 16
4: 302
1060155097_1060155107 24 Left 1060155097 9:121313995-121314017 CCAACCGCAAGCTGGCCAAGCTC 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1060155107 9:121314042-121314064 GTCTGCCTGGGCATGGGGTCAGG 0: 1
1: 0
2: 2
3: 43
4: 416
1060155097_1060155110 30 Left 1060155097 9:121313995-121314017 CCAACCGCAAGCTGGCCAAGCTC 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1060155110 9:121314048-121314070 CTGGGCATGGGGTCAGGACAGGG 0: 1
1: 0
2: 3
3: 65
4: 533

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060155097 Original CRISPR GAGCTTGGCCAGCTTGCGGT TGG (reversed) Exonic
902448756 1:16483988-16484010 GTGCTTGGGCAGCTGGGGGTGGG - Intergenic
902468136 1:16630661-16630683 GTGCTTGGGCAGCTGGGGGTGGG - Intergenic
902506023 1:16939368-16939390 GTGCTTGGGCAGCTGGGGGTGGG + Intronic
903155006 1:21437027-21437049 GTGCTTGGGCAGCTGGGGGTGGG + Intergenic
904813829 1:33181220-33181242 GATGTTGGCCAGCTTGAGGCTGG + Exonic
904858921 1:33520558-33520580 GTGCCTGGCCATCTTGCAGTAGG + Intronic
914490355 1:148147364-148147386 GAGCTTGGCCATCCTGGGGCAGG + Intronic
915672957 1:157505585-157505607 GGGCTGGGCCAGCCTGCGTTAGG - Intergenic
921390181 1:214607850-214607872 GAGCTTGGCCATCCTGGGGCAGG - Intronic
1065522287 10:26584547-26584569 GAGCTAGCCCCGCTTGCGGCTGG - Intergenic
1070828575 10:79405198-79405220 GAGTTTGGCAAGCTGGAGGTTGG - Intronic
1072961273 10:99931397-99931419 GAGCTTCAGCAGCTTGCGATTGG - Intronic
1074993382 10:118732495-118732517 GAGCTTGCTCTGCTTGCGGGAGG + Intronic
1075311384 10:121416878-121416900 GAGGTTGGCCATCTGGAGGTTGG + Intergenic
1075653739 10:124147489-124147511 GAGCTTGGGGAGCTTGGGGTGGG - Intergenic
1076858260 10:133127888-133127910 GGGCGTGGCCAGCGTGGGGTGGG - Intronic
1077024930 11:434935-434957 GAGCTTGGCGAGGATGCGGCTGG - Intronic
1078077246 11:8173263-8173285 GAGCTGGGGCAGCTTGGAGTGGG + Intergenic
1078354876 11:10626035-10626057 GGCCTTGGCCAGCTTGCCGCCGG + Exonic
1078631815 11:13010115-13010137 GAGCTTGGCCAGTTTGCGAAAGG - Intergenic
1083965727 11:66042642-66042664 GGGCATGGCCAGCTTGAGGCAGG + Exonic
1085319784 11:75566891-75566913 GACCTCGGGCAGCTTGCCGTCGG - Exonic
1085765509 11:79278473-79278495 GACCTGGGCCTGCTTGCGATGGG + Intronic
1091799811 12:3317701-3317723 GAGCTTGCCCAGCTTGCTCTGGG - Intergenic
1096532779 12:52252395-52252417 CAGCTCGGCCAGCTTGCAGCGGG + Intronic
1096537935 12:52287236-52287258 CAGCTCGGCCAGCTTGCAGCGGG + Exonic
1096542534 12:52316027-52316049 CAGCTCGGCCAGCTTGCAGCGGG + Exonic
1096547411 12:52350177-52350199 CAGCTCAGCCAGCTTGCAGTGGG - Intergenic
1096773375 12:53950240-53950262 GGGCTTGGGCAGATTGGGGTGGG - Intergenic
1098264703 12:68706675-68706697 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1100244144 12:92739520-92739542 AAGCTTGGACAGCTTACAGTGGG - Intronic
1102447500 12:113014950-113014972 GAGCTTGGTCAGATTGCAGCAGG + Intergenic
1103762719 12:123263348-123263370 GAGCTTGGTAAGCTTGGGCTTGG + Intronic
1104804287 12:131575232-131575254 GAGCAGGGCCAGCCTGCGCTGGG - Intergenic
1105855269 13:24366276-24366298 GAGCCTGGCCAGCTTGGTGCCGG - Intergenic
1113298313 13:108986886-108986908 GAACTTGGCCATCTAGCTGTAGG - Intronic
1119433884 14:74585639-74585661 GGGCTTTGCCAGCCTGGGGTGGG - Intronic
1119766886 14:77195967-77195989 GGGCTTGGCCAGCCTGGGCTTGG + Intronic
1122601830 14:102925421-102925443 GAGCGTCGCCATCTTGCTGTGGG - Intronic
1126131575 15:45347110-45347132 GGACTTGGCCTGCTTGTGGTGGG - Intergenic
1129034633 15:72641840-72641862 GGGCTGGGCCAGCCTGAGGTTGG - Intergenic
1129215249 15:74095376-74095398 GGGCTGGGCCAGCCTGAGGTTGG + Intergenic
1136604685 16:31325379-31325401 GAGCGTGGACACCTTCCGGTAGG - Exonic
1138536402 16:57662671-57662693 GAGCGTGGCCAGATGGCGGCGGG + Intronic
1139576644 16:67846556-67846578 CAGCTGGGCCAGCTTGGGGCCGG + Intronic
1140033737 16:71357972-71357994 GAGCATGGCCAGCGTGAGGCAGG + Intergenic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1142003692 16:87679111-87679133 GAGCCTGGCCAGCTGGGGGATGG - Intronic
1142222677 16:88863433-88863455 GTGCCAGGCCAGCTTGGGGTTGG - Exonic
1145190949 17:20841967-20841989 GAGCTTGGCCATCCTGGGGCAGG + Intronic
1146161983 17:30565011-30565033 GATCTTGGCCACCTTGGGGCAGG - Intergenic
1146646934 17:34581993-34582015 GAGCGTCTCCAGCTTGCGGAAGG - Intronic
1146656501 17:34638030-34638052 GAACTTGACCCGCTTGCGCTTGG - Exonic
1147186698 17:38716938-38716960 GAGCTTGCCCAGCTTGAGCCTGG + Exonic
1148438410 17:47699313-47699335 GAGCCCGGCCAGCCTGCTGTCGG - Exonic
1148691426 17:49529096-49529118 GAGGGAGGCCAGCTTGCAGTGGG - Intergenic
1148846669 17:50533755-50533777 GAGCAGGGCCAGCAGGCGGTGGG - Intronic
1152618609 17:81349561-81349583 GGGCTTGGCCAGGTGGAGGTCGG + Intergenic
1152647483 17:81476193-81476215 GAGCGTGGCCACCCTGTGGTGGG + Intergenic
1156545823 18:37962736-37962758 GACCTTGGGCAGATTGCTGTAGG + Intergenic
1160995255 19:1879456-1879478 GAGCTTGGCCATCCTGGGGCAGG - Intronic
1162530972 19:11236389-11236411 GAGCTTGTCCAGCACGTGGTGGG + Exonic
1165886519 19:39083134-39083156 GGGCTTGACCAGCTTGCCATAGG + Intergenic
1167655179 19:50759080-50759102 GAGCTTGGCCCGGATGAGGTGGG - Intergenic
1167656978 19:50771307-50771329 GAGCTTGGCCCGGATGAGGTGGG - Exonic
1168592198 19:57646686-57646708 GTGCTTGGCCAGCTTGGGATTGG - Intergenic
928194983 2:29209202-29209224 GAGCATGGCCAGATTACAGTTGG + Intronic
934139015 2:89027326-89027348 GAGCCTGGCCAGGTTTCTGTTGG + Intergenic
936047807 2:109200641-109200663 CAGCTTGGCCAGGTAGGGGTGGG - Intronic
940420806 2:153477902-153477924 GAGCTTGGCCCACCTGCGGGTGG + Exonic
943009291 2:182427008-182427030 GAGCTTGACCAGCATGTGGAAGG - Intronic
947157376 2:227175992-227176014 TAGCTTGGCAATCTTGCTGTGGG - Intronic
948401189 2:237686798-237686820 GAGCTGGACCAGCTGGCCGTGGG + Intronic
1168977749 20:1980794-1980816 GAGCTTGGCCAGCTCACTGTAGG + Exonic
1170457503 20:16547207-16547229 GGGCATGGCCAGCTTGCCTTAGG - Intronic
1170931717 20:20774509-20774531 GAGCTTGGGCAGCCTGCACTGGG - Intergenic
1171416426 20:24984127-24984149 GAGGTCGGCCAGCTTGCAGTGGG - Intronic
1175543241 20:59761381-59761403 CAGCTTGGGCAGCTGGCTGTGGG - Intronic
1179792724 21:43764736-43764758 GGGCCTGGCCAGCATCCGGTAGG + Intergenic
1181104411 22:20565223-20565245 GGGCTTGGGCATCTGGCGGTGGG + Intronic
1181121332 22:20669996-20670018 GAGCTTGGCCATCCTGGGGCAGG - Intergenic
1181334289 22:22117021-22117043 GAGCTTGGCCATCCTGGGGCAGG - Intergenic
1182103407 22:27672594-27672616 GAGCTGGGCCAGGGTGGGGTGGG - Intergenic
1182808976 22:33099674-33099696 GGGCTTGGACAGCTTGAAGTTGG + Intergenic
1183272639 22:36871717-36871739 GAGCCTGGCCAGCGTGGGGGCGG - Intronic
1185285028 22:49996271-49996293 GAGCTTGCCTAGCTTCGGGTGGG - Exonic
1185413667 22:50698387-50698409 GAGCATGGTCAGCTGGGGGTGGG + Intergenic
960810283 3:121621659-121621681 GTGCTTGGCCAGTTTGTGGCGGG - Exonic
961396672 3:126598174-126598196 TAGCTGGGCCTGCTTGTGGTGGG - Intronic
968891962 4:3374245-3374267 GTGCTGGGCCAGCTTGCCTTGGG + Intronic
975571695 4:75824410-75824432 TACATTGGCCAGCTTGTGGTGGG - Intergenic
976071188 4:81241609-81241631 GAGCTTGGCTAGCCTGCTGAAGG + Intergenic
976812003 4:89108403-89108425 GAGCTGGGCCACCTTGCAGGTGG + Intronic
977423106 4:96828645-96828667 GAGCTTTGGAAGCTTGAGGTAGG - Intergenic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
987171499 5:15263827-15263849 GAGCTGTGCCAGCTTGGGGGAGG - Intergenic
988499893 5:31775933-31775955 GAGTGTGGCCAGCATGCGTTAGG + Intronic
989189414 5:38655462-38655484 GAGTTTGGCAAGCTTTCAGTGGG - Intergenic
991184303 5:63789317-63789339 GTGCTTGGCCACCTTGCAGGAGG + Intergenic
992230153 5:74656069-74656091 AAGCTGGGCCACCTTGGGGTTGG + Intronic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
997470600 5:134115037-134115059 GAGCTCGGCCAGGTCGCGCTCGG - Exonic
999144026 5:149380980-149381002 GGGCTGGGACAGCCTGCGGTGGG - Intronic
1000192976 5:158930415-158930437 GAGCCTGGCCATCATGCGGCAGG + Intronic
1004198163 6:13524368-13524390 GAGCCTGGCCAGCTAGCGGCAGG - Intergenic
1008209281 6:48701667-48701689 GATCTTGGCCAGGTTGTGGCTGG + Intergenic
1008491159 6:52088603-52088625 GTGCTTGGCCAGATTGGGGCAGG + Intergenic
1011705862 6:90000993-90001015 GAACTTGGCTAGCTTCCTGTTGG - Intronic
1018317263 6:162569322-162569344 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1019573778 7:1726472-1726494 GAGCTGGGCCAGCTTGGCCTTGG - Intronic
1025868207 7:65405785-65405807 GACCTTGTGCAGCTTGTGGTGGG + Intergenic
1025959908 7:66210715-66210737 GAGTTTGGGCAGATTGAGGTGGG + Intronic
1029211057 7:98908736-98908758 GAGGTCGGCCAGCGTGCTGTAGG - Exonic
1029281183 7:99436698-99436720 GAGACTGGCCAGCTTGGGCTGGG + Intronic
1032790389 7:135238281-135238303 CAGCTTGGCCAGCATGCTCTGGG + Intronic
1033327355 7:140390642-140390664 GAGCTTATCCACCTGGCGGTGGG - Intronic
1035316855 7:158001937-158001959 CAGCTTGGCCAGCTTCCGGCTGG - Intronic
1036758236 8:11486107-11486129 GAGCTGTGCCAGCTTGGGATTGG - Intergenic
1042271541 8:66961502-66961524 CAGCTTGGACAGCTTGGTGTCGG + Exonic
1045540054 8:103075773-103075795 GAGGGTGGCCAGCTAACGGTAGG - Intergenic
1046696320 8:117343883-117343905 GAGCTTTGCCACCTTGTGGGAGG - Intergenic
1049340473 8:142109675-142109697 GCTCTTGGCCAGCTGGCGGGAGG - Intergenic
1049688735 8:143949666-143949688 GTGCTTGGCCAGCTTGGACTTGG - Intronic
1049746928 8:144266933-144266955 AATCTTGGAGAGCTTGCGGTCGG - Exonic
1050174838 9:2859012-2859034 GAGTGTGGCCAGCTTGAGGGAGG - Intergenic
1052963276 9:34318945-34318967 GACCTTGGGCAGCTTGCCGTCGG - Intronic
1057217088 9:93235075-93235097 GAGCTTGGCCATTTTGCAGAGGG + Intronic
1058904381 9:109469806-109469828 GGGCTAGGCCAGCTTGATGTAGG - Intronic
1059119806 9:111631610-111631632 GCGCCGGGCCAGCTGGCGGTAGG - Exonic
1060155097 9:121313995-121314017 GAGCTTGGCCAGCTTGCGGTTGG - Exonic
1060868043 9:127015528-127015550 GAGCTTGGCTTCCTGGCGGTTGG + Intronic
1060978361 9:127778646-127778668 GCCCTTGGCCAGCTTGCGAGTGG + Exonic
1061230016 9:129310197-129310219 GAGGTTGGCCAGGTGGCGCTGGG - Intergenic
1061662862 9:132141800-132141822 GCGCTTTCCCAGGTTGCGGTTGG - Intergenic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic
1189717515 X:43881628-43881650 CAGCTTGGCCACCCTGCGCTAGG + Intronic
1193566049 X:83078354-83078376 GAGCTGTGCCAGATTGGGGTAGG + Intergenic
1195672565 X:107482198-107482220 GAGCATGGCCACCTTGCTGTGGG - Intergenic
1199300229 X:146204745-146204767 GAGCTGGGCCACCTGGGGGTAGG + Intergenic