ID: 1060156626

View in Genome Browser
Species Human (GRCh38)
Location 9:121324830-121324852
Sequence CCATGGCTACAGATGCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 145}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060156626_1060156635 24 Left 1060156626 9:121324830-121324852 CCACACTGCATCTGTAGCCATGG 0: 1
1: 0
2: 2
3: 12
4: 145
Right 1060156635 9:121324877-121324899 CTAGTGGACTTTGCTGTCTTGGG No data
1060156626_1060156636 27 Left 1060156626 9:121324830-121324852 CCACACTGCATCTGTAGCCATGG 0: 1
1: 0
2: 2
3: 12
4: 145
Right 1060156636 9:121324880-121324902 GTGGACTTTGCTGTCTTGGGTGG No data
1060156626_1060156634 23 Left 1060156626 9:121324830-121324852 CCACACTGCATCTGTAGCCATGG 0: 1
1: 0
2: 2
3: 12
4: 145
Right 1060156634 9:121324876-121324898 CCTAGTGGACTTTGCTGTCTTGG No data
1060156626_1060156629 8 Left 1060156626 9:121324830-121324852 CCACACTGCATCTGTAGCCATGG 0: 1
1: 0
2: 2
3: 12
4: 145
Right 1060156629 9:121324861-121324883 ACACACTGTCCCTGCCCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060156626 Original CRISPR CCATGGCTACAGATGCAGTG TGG (reversed) Intronic
902669086 1:17960003-17960025 CCATGGCCCAAGATCCAGTGAGG + Intergenic
903971860 1:27124072-27124094 CCAGGGATAGAGATGGAGTGGGG - Intronic
905692539 1:39954217-39954239 ACATGGCTCCAGAGGCACTGAGG - Intergenic
906913434 1:49982222-49982244 CCATGGTGCCAGGTGCAGTGGGG + Intronic
909502179 1:76346600-76346622 GCACAGCTACAGAGGCAGTGGGG + Intronic
910095533 1:83517396-83517418 CCATGGTTACATATGGATTGAGG - Intergenic
911000414 1:93159242-93159264 CCAGGGATACACATGCAGGGTGG - Intronic
912692975 1:111818591-111818613 CCAGGGGAACAGATGGAGTGCGG + Intronic
912711924 1:111956250-111956272 CCAGGGCTCCAGATGCACAGGGG - Intronic
913090855 1:115475650-115475672 CCATGCCTTCAGCTTCAGTGTGG - Intergenic
915650334 1:157305441-157305463 CCATGTGTACAGATGCAGAGTGG - Intergenic
915687191 1:157645402-157645424 CCCTGGTCACAGATGCACTGAGG - Intergenic
923689288 1:236176963-236176985 CCATGGGTACACAGGCAGTCAGG - Intronic
924856415 1:247879328-247879350 CCATGGTTACAGCAGCAGGGTGG - Intergenic
1066461527 10:35616592-35616614 CCATGGTTAGACAGGCAGTGAGG - Intergenic
1069868299 10:71517713-71517735 GCATGGTTATAGATGCAGAGGGG - Intronic
1070702094 10:78611492-78611514 CAATGGCTCCGGATGGAGTGAGG + Intergenic
1075198708 10:120383291-120383313 CCACGTCTACAGAAGCTGTGTGG + Intergenic
1078042888 11:7884519-7884541 CCAGGTCTACAGCTGCAGTGTGG + Intergenic
1078565523 11:12410747-12410769 CCATAGCTATAGATGGGGTGGGG - Intronic
1079004546 11:16782694-16782716 CCAAGCCCACAGGTGCAGTGGGG + Intronic
1083801995 11:65052243-65052265 CCAGGGCTGGAGATGCTGTGGGG - Intronic
1083912965 11:65720657-65720679 GCAGGGCAGCAGATGCAGTGTGG + Exonic
1085482725 11:76836234-76836256 CAATATCTACATATGCAGTGAGG + Intergenic
1087125468 11:94621691-94621713 CTATGGGTACAGATGCCGTTAGG - Intergenic
1088513183 11:110599163-110599185 CTATGTCTACAGTTGCAGTTTGG - Intronic
1089357914 11:117867351-117867373 ACTTTGCCACAGATGCAGTGTGG - Intronic
1089639489 11:119838390-119838412 CCAGGACTACTGATGCTGTGAGG - Intergenic
1090137339 11:124210894-124210916 CCATGGTGCCAGCTGCAGTGGGG - Intergenic
1090910261 11:131111987-131112009 CCATGACGCCAGCTGCAGTGGGG - Intergenic
1091765680 12:3118650-3118672 CAAGGGCTGCAGGTGCAGTGGGG - Intronic
1094287455 12:28811406-28811428 CAATGGCTGCAGATGCTATGTGG - Intergenic
1101212784 12:102551374-102551396 CGATGGCCACATATGCAGAGAGG - Intergenic
1101877083 12:108603217-108603239 CCATGGCTAGGGAGGCAGGGAGG + Intergenic
1102002412 12:109565757-109565779 CCTTGGCTAGAGAGGCAGGGAGG + Intronic
1102023789 12:109701580-109701602 CCTTGGCTCCACTTGCAGTGTGG + Intergenic
1106322114 13:28650485-28650507 CCATTCCTACAGATGCAGTAAGG - Intergenic
1108275304 13:48803224-48803246 TCATGACTGGAGATGCAGTGAGG + Intergenic
1112112840 13:96321770-96321792 GCATGGGTACAGATGCAGAGAGG - Intronic
1118522143 14:66596897-66596919 CAATGACACCAGATGCAGTGGGG - Intronic
1119981833 14:79090580-79090602 CCATGGTGACAGAAGCACTGGGG - Intronic
1121442665 14:93958581-93958603 CCACAGCTACAGAAACAGTGTGG - Intronic
1122543876 14:102511705-102511727 CCATGGCTACTGGTGGAATGAGG + Intergenic
1123716339 15:23035626-23035648 CCATGGCAGGAGGTGCAGTGGGG - Intronic
1124998640 15:34748348-34748370 CCACGGCTACAGATGCATAAAGG + Intergenic
1127365552 15:58285733-58285755 CCATGTCTCCAGGTGCAGTGTGG + Intronic
1129737327 15:77973608-77973630 GCCTGGCTATAGATGCTGTGTGG - Intergenic
1129848745 15:78780017-78780039 GCCTGGCTATAGATGCTGTGTGG + Intronic
1131116715 15:89800422-89800444 CCAAGGCTACAGATGAAGGAAGG - Intronic
1132666877 16:1085021-1085043 CCATGGCTGCCAGTGCAGTGGGG + Intergenic
1137888681 16:52134461-52134483 ACATGGCTATTGATGCAGTTTGG - Intergenic
1143328798 17:6119254-6119276 CCATGAATAAAGCTGCAGTGGGG - Intronic
1143355811 17:6327638-6327660 CCACGGATACAGATGCAGAGTGG - Intergenic
1143973482 17:10812933-10812955 TCATGGCTAGAGAGGCAGTTAGG - Intergenic
1149372640 17:56010454-56010476 GCATAGCAACAGCTGCAGTGGGG - Intergenic
1154330038 18:13421883-13421905 CCAAGGCTGCAGGTGCAGCGAGG - Intronic
1155395981 18:25387328-25387350 CCATGGGTAGAGATGGGGTGGGG - Intergenic
1157046592 18:44107526-44107548 GGATGGCCACAGATGCAGGGAGG + Intergenic
1158806909 18:60984755-60984777 TGATTGCTACAGATGCAGTTGGG - Intergenic
1159334209 18:67043370-67043392 CCATGACGCCAGCTGCAGTGGGG + Intergenic
1163045871 19:14641479-14641501 CGAGAGCTGCAGATGCAGTGAGG + Exonic
1163059801 19:14752389-14752411 CGAGAGCTGCAGATGCAGTGAGG + Exonic
1163132011 19:15280163-15280185 CCATGGGGACAGAGGCAGAGTGG + Intronic
1168155354 19:54471256-54471278 CCACGGCTCCAGCTGCAGGGTGG + Intronic
928359992 2:30655043-30655065 CTGTGGCTACAGGGGCAGTGGGG + Intergenic
931750080 2:65322625-65322647 CCCTGGCAAAAGATGCAATGAGG - Intronic
934947813 2:98554630-98554652 CCTTGGCTCCTGATGCAGGGAGG + Intronic
940513044 2:154643112-154643134 TTATGGCTACAGAGGCAGTGGGG - Intergenic
942555168 2:177165348-177165370 CCATGGCTGCAGAAGCTGTAGGG + Intergenic
945297322 2:208183544-208183566 CCAGGGGTACAGGGGCAGTGTGG + Intronic
945493428 2:210481954-210481976 CCAGGGCTGCAGCTGCAGAGAGG + Intronic
946517184 2:220425539-220425561 ACATGGCCACAGCAGCAGTGGGG - Intergenic
947370634 2:229442014-229442036 CCCTTGCTACAGATGCAGCTGGG + Intronic
948292578 2:236837017-236837039 TGATGGCTACAGATGCAGCATGG + Intergenic
948320087 2:237062077-237062099 CCATGGCTGCAGATGCCCTCTGG + Intergenic
1168983546 20:2027471-2027493 CCATGACACCAGCTGCAGTGGGG - Intergenic
1170900221 20:20455328-20455350 CCGTGGTTCCAGATGCAGAGTGG + Intronic
1171283062 20:23917526-23917548 CCATGCCTACAGCTGCAGTGAGG - Intergenic
1171425624 20:25046849-25046871 CCCTGGTTGCAGATGCCGTGTGG - Intronic
1171804489 20:29662602-29662624 CTACAGCTACAGCTGCAGTGTGG + Intergenic
1172435461 20:34926030-34926052 CCATGGGTACAGATGGAGCATGG + Intronic
1174193840 20:48758840-48758862 CCATGGTGACAGGTGCTGTGAGG - Intronic
1174194159 20:48761257-48761279 CCATGGTGACAGGTGCTGTGAGG - Intronic
1175584237 20:60125163-60125185 CCATGGTTGCAGATGCAGTTAGG + Intergenic
1175625857 20:60487699-60487721 CCAGGGCAGCAGGTGCAGTGAGG + Intergenic
1177015599 21:15782879-15782901 CCATTACTAAAGATGCATTGTGG - Intronic
1181029853 22:20144446-20144468 ACAGGGCGACAGATGCCGTGAGG - Intronic
1182657066 22:31899185-31899207 CCATGGTTACAGCTGCAGAAAGG + Intronic
1183295325 22:37025824-37025846 CCATGGCTACAGATTGGGTTTGG + Intronic
1184683916 22:46087453-46087475 CCATGCCGACAGATGGGGTGGGG - Intronic
950840019 3:15959166-15959188 CCCTGCCTTCAGCTGCAGTGTGG + Intergenic
954420210 3:50414963-50414985 GCATGGCTTCAGAGGCACTGAGG + Intronic
958977193 3:100682058-100682080 CCATGGCTCCGGCTGCAGTGGGG + Intronic
964441786 3:156718800-156718822 CCATGAGTACAGCTGCAGTCTGG - Intergenic
965447225 3:168789930-168789952 CCCTCGCTACAGCTGCTGTGGGG - Intergenic
969121947 4:4917270-4917292 CCATGGCTGGAGCTGCAGAGAGG + Intergenic
969153518 4:5190483-5190505 CCATGACACCAAATGCAGTGTGG - Intronic
971218041 4:24680258-24680280 TCTTGTCTACAGATTCAGTGTGG - Intergenic
981543107 4:145866127-145866149 CCAAGGGCAGAGATGCAGTGGGG - Intronic
981587475 4:146319952-146319974 ATATGGCTACAGATGCAGGTGGG + Intronic
982608850 4:157548714-157548736 CCATGGCCACAAATGCAGTGTGG + Intergenic
982862400 4:160469746-160469768 GCAGGGATACAGATGCAGTCTGG - Intergenic
983873681 4:172851615-172851637 CCATTGCTACAGAAACAGTATGG - Intronic
984631877 4:182069818-182069840 CTAAGGCTACAGATGAAGGGAGG + Intergenic
985267116 4:188160573-188160595 CCCTGGCTCCAGAAGCAGAGAGG - Intergenic
986585236 5:9309548-9309570 CCATGCCTCCAGAGGCAGTAGGG - Intronic
987250387 5:16094994-16095016 CCAAGGTTACACATCCAGTGAGG + Intronic
988348733 5:30072811-30072833 CCCTTGCTGCAGAGGCAGTGTGG - Intergenic
989373974 5:40740519-40740541 CCATGGCCACATATGCAGCAAGG + Intronic
990953288 5:61319714-61319736 CCATGGCTGGAGCTGCAGAGGGG + Intergenic
991471069 5:66969656-66969678 CCATGGCAACAAGTGAAGTGAGG - Intronic
992177566 5:74165355-74165377 CCATGGATTCAGATTCAGTGGGG + Intergenic
993782398 5:92083763-92083785 CCATGGATACTGCTGCAATGCGG + Intergenic
996556277 5:124782269-124782291 CCATGGTTACGGATGCAATCAGG - Intergenic
997882384 5:137602274-137602296 CCAAGGCTACACAGTCAGTGAGG + Intergenic
1000010372 5:157225635-157225657 CCATGGTTTGAGAGGCAGTGTGG + Intronic
1001412166 5:171519567-171519589 CAATGGCAAGAGATGCAGTTGGG + Intergenic
1003020874 6:2508346-2508368 CAATGGCTACAGGTGGAGTGGGG + Intergenic
1003522186 6:6867703-6867725 CCAGGGCCTGAGATGCAGTGAGG + Intergenic
1003743514 6:8971023-8971045 CCATTGCTACAGACCAAGTGTGG - Intergenic
1003916064 6:10787307-10787329 CTATTGCTAAAGAAGCAGTGTGG + Intronic
1007493442 6:42242536-42242558 CCATGGCTATGGATGCAGGGTGG + Intronic
1007763351 6:44147135-44147157 GCATGTCCTCAGATGCAGTGGGG - Intronic
1012490587 6:99779306-99779328 CCCTTGCTAGAGAGGCAGTGTGG + Intergenic
1015679410 6:135787896-135787918 TCATGGCTAGTGATGGAGTGGGG + Intergenic
1015852697 6:137590046-137590068 CCATTGCTACAGACCTAGTGTGG - Intergenic
1017806026 6:157946238-157946260 AGCTTGCTACAGATGCAGTGTGG - Intergenic
1018060860 6:160088559-160088581 CCCTGGCACCAGATGCAATGTGG - Intronic
1018692941 6:166363676-166363698 CCATGGTCCCAGCTGCAGTGTGG + Intergenic
1019289756 7:244664-244686 CAATGGCCACAGACCCAGTGGGG + Intronic
1019621935 7:1996650-1996672 CCGTGGCTACAGCAGCACTGAGG - Intronic
1021270168 7:18575030-18575052 CCATGACACCAGCTGCAGTGGGG - Intronic
1024921491 7:54561396-54561418 CCATTGCTACATAGGCAGTCTGG - Intronic
1029298770 7:99562008-99562030 CTATTGCTACTGATGGAGTGTGG + Intronic
1029710094 7:102294756-102294778 ACCTGGCTACAGATGGAGAGAGG - Intronic
1033539649 7:142345018-142345040 ACATGACCACGGATGCAGTGTGG - Intergenic
1033930727 7:146517239-146517261 CCATGGTTTCAGATCCACTGGGG + Intronic
1034708443 7:153169695-153169717 TCATTGCTACAGAGACAGTGTGG + Intergenic
1034824614 7:154250364-154250386 CCATGTCAACACCTGCAGTGTGG + Intronic
1034892340 7:154852374-154852396 CCAGGGAGACAGATGCACTGTGG - Intronic
1036910080 8:12751145-12751167 CTATGGATAGACATGCAGTGTGG - Intronic
1043883089 8:85567114-85567136 CCCTGGCTACAGGTCAAGTGAGG + Intergenic
1044890424 8:96829229-96829251 CCATGGATTTTGATGCAGTGGGG + Intronic
1044952981 8:97451630-97451652 CAATGGCACCAGATGGAGTGAGG - Intergenic
1046395610 8:113634161-113634183 CCATTGCTCCGGCTGCAGTGGGG - Intergenic
1051029779 9:12659203-12659225 CCATGACACCAGCTGCAGTGGGG - Intergenic
1051486070 9:17609515-17609537 CACTGGCTACAGCTGCAGGGAGG - Intronic
1054950556 9:70846263-70846285 CCATGGGTAGGGATGAAGTGGGG + Intronic
1058759544 9:108117798-108117820 CCAAGACTTCAGATGCTGTGAGG + Intergenic
1058826279 9:108778475-108778497 CCATGGCTACCCATTCACTGAGG - Intergenic
1060156626 9:121324830-121324852 CCATGGCTACAGATGCAGTGTGG - Intronic
1060707721 9:125820152-125820174 CTTGGGCTACAGATCCAGTGTGG - Intronic
1187990728 X:24869394-24869416 ACATGGCTCCTGAAGCAGTGAGG + Intronic
1188381045 X:29492963-29492985 CCAAGGCTAGAGATGAAGCGTGG - Intronic
1193266161 X:79472338-79472360 TCATGGTTGCTGATGCAGTGTGG - Intergenic
1193270940 X:79530147-79530169 CCCTGGTTAAAGAAGCAGTGTGG + Intergenic
1194000913 X:88427679-88427701 CCATGGCTACAGCTCCTGAGGGG - Intergenic
1194316001 X:92379025-92379047 CCATGACACCAGCTGCAGTGGGG + Intronic
1197761331 X:130030524-130030546 CCATGGCTCCAGAGGCAGACAGG - Intronic
1200624050 Y:5490599-5490621 CCATGACACCAGCTGCAGTGGGG + Intronic