ID: 1060163848

View in Genome Browser
Species Human (GRCh38)
Location 9:121392335-121392357
Sequence ACTGAGCACCTAATGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060163846_1060163848 -8 Left 1060163846 9:121392320-121392342 CCAGGTGTTGGAGGAACTGAGCA No data
Right 1060163848 9:121392335-121392357 ACTGAGCACCTAATGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060163848 Original CRISPR ACTGAGCACCTAATGGAGAA AGG Intergenic
No off target data available for this crispr