ID: 1060166955

View in Genome Browser
Species Human (GRCh38)
Location 9:121425315-121425337
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 2, 1: 18, 2: 49, 3: 70, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060166953_1060166955 -7 Left 1060166953 9:121425299-121425321 CCAAATCAGAGTTGCTGTTCAGC No data
Right 1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG 0: 2
1: 18
2: 49
3: 70
4: 164
1060166952_1060166955 5 Left 1060166952 9:121425287-121425309 CCAAAGGAGATGCCAAATCAGAG 0: 25
1: 40
2: 53
3: 80
4: 220
Right 1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG 0: 2
1: 18
2: 49
3: 70
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060166955 Original CRISPR GTTCAGCAGCACCACGCTGT GGG Intergenic
900622346 1:3593217-3593239 GTTCAGCCGCTCCCCGCTGTGGG - Intronic
901768915 1:11520777-11520799 GTCCAGCAGCACCTGGATGTTGG - Exonic
901842602 1:11963603-11963625 GATCAGCAGCCGCAGGCTGTTGG - Exonic
902569357 1:17336952-17336974 ATTAAGCAGCCCCACCCTGTAGG - Intronic
902802617 1:18839752-18839774 GGTGACCAGCACCCCGCTGTAGG + Exonic
904012788 1:27399346-27399368 GCTGAGCAGCTCCAGGCTGTGGG - Intergenic
904275289 1:29379820-29379842 ATTAAGCAGCACCATGCTGTAGG - Intergenic
904426565 1:30427628-30427650 GTTCAGCAGCACCACATTGTAGG + Intergenic
905043107 1:34976602-34976624 GCTCAGCAGCGCCAGGCTGAGGG + Intergenic
905435927 1:37955115-37955137 GTTTAGCAGCACCAATCTGAGGG + Intergenic
909460608 1:75908955-75908977 GTACAGCAGCACCATGCTAGAGG - Intronic
911753025 1:101520571-101520593 GTTCAACAGCACCATGTTATAGG - Intergenic
912640665 1:111342537-111342559 GTTCAGCAGTGCAAAGCTGTAGG - Intergenic
912731344 1:112109053-112109075 GTTGAGCAGCACCATGCAGTAGG - Intergenic
915801430 1:158797070-158797092 GTTCAGTAGAACCTCACTGTAGG - Intergenic
915880371 1:159664796-159664818 GTTCAGCAGCACCATGCAGTAGG - Intergenic
916468373 1:165094930-165094952 GTTCAGCAGCACCACAGCGTAGG + Intergenic
918229868 1:182518431-182518453 GTTCAGCAACATCACACTGTAGG - Intronic
918621033 1:186606102-186606124 GTTCAGCAGCACCGGGCTCTAGG - Intergenic
918969559 1:191396971-191396993 TTTCAGCAGCACCCCGCTCTTGG - Intergenic
921942195 1:220853730-220853752 GTTCAGCAGCACCATGCTGTAGG - Intergenic
923937656 1:238781381-238781403 GTTCAGCACCATCATGCTGTAGG - Intergenic
1065496570 10:26335410-26335432 GTTTGGCAGCACCATGCTGTAGG - Intergenic
1065823717 10:29550821-29550843 GTTCAGCAGCACCTCCGGGTCGG + Exonic
1068007249 10:51406170-51406192 GTTCTGCAGCAGCAGGCAGTGGG - Intronic
1069804693 10:71112980-71113002 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1070040357 10:72772204-72772226 GTTCAGCAGCACCATGCTGTAGG + Intronic
1070584859 10:77756487-77756509 GTTCAGTAGCACCACACTGTAGG + Intergenic
1072054886 10:91745224-91745246 ATTCAACAGCACCATGCCGTAGG + Intergenic
1072675629 10:97463783-97463805 GTTGAACAGCACCACCCTCTGGG - Intronic
1072772096 10:98150713-98150735 GTTCAGCAGCACCACGCTGTAGG - Intronic
1074893796 10:117757439-117757461 GTTCAGCAGCCCAAGGCTGAGGG - Intergenic
1075056397 10:119222058-119222080 GATCATCAGCACAACCCTGTGGG + Intronic
1075206860 10:120456449-120456471 GTTCAGCAGCCCCAAGCTGCTGG + Intergenic
1076238505 10:128884177-128884199 GTTCAGCGGCATCAGGCTGAAGG - Intergenic
1076926329 10:133490001-133490023 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1077930297 11:6724274-6724296 GTTTAGCAGCAGCACATTGTAGG + Intergenic
1080192481 11:29568804-29568826 GTTCAGCAGCACTATGCTGTGGG + Intergenic
1080716995 11:34812505-34812527 GTTCAGCAGCACCATACTGTAGG + Intergenic
1080923985 11:36737185-36737207 GTTAAGCAGCAGTACCCTGTAGG - Intergenic
1081040292 11:38201496-38201518 ATTCAGCAGCATCATGCTGTAGG + Intergenic
1082238589 11:49850567-49850589 AGCCAGCAGCACCACGCTGGGGG - Intergenic
1082243557 11:49893763-49893785 AGCCAGCAGCACCACGCTGGGGG + Intergenic
1082935428 11:58652094-58652116 GCTCAGCAGCACCATGCTATAGG - Intronic
1083919663 11:65775515-65775537 CTGCAGCAGCACCACGCTTCTGG + Intergenic
1084365294 11:68693585-68693607 GGTCAGCAGCACAAAGGTGTCGG + Intergenic
1085457763 11:76674823-76674845 TTTCTGCAGCACCAGGCTGCTGG + Intergenic
1086035960 11:82414702-82414724 TTTTAGCAGCACCATGCTGTAGG + Intergenic
1087411278 11:97792851-97792873 GTCCAGCATCACTACACTGTAGG - Intergenic
1091865958 12:3837128-3837150 ATTCAGCAACACCACATTGTAGG + Intronic
1092671570 12:10867713-10867735 GTTCAATAGCACCATGCTTTAGG - Intronic
1092865709 12:12759034-12759056 GTCCAGCTGAACCACACTGTAGG - Intronic
1092941391 12:13410465-13410487 GTTTAGCAGCACCATGCTGTAGG + Intergenic
1093142663 12:15527549-15527571 GTTCAGCAGCACCATACTGTAGG + Intronic
1094471694 12:30807462-30807484 CTTCAGCAGCACCATGCTGTAGG + Intergenic
1095777632 12:46026740-46026762 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1097646236 12:62237908-62237930 GTTCAGCAACACCAAGATGTAGG - Intronic
1097786700 12:63768041-63768063 GTGCAGCAGCACCCAGCTGAGGG + Intergenic
1099434551 12:82627897-82627919 GTTCAGCAGCACCGCACTGTAGG + Intergenic
1100804463 12:98266800-98266822 GTTCAGGAGCCCTATGCTGTAGG + Intergenic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1101792611 12:107941592-107941614 GTTCAGCTGCACCATGCAGAAGG + Intergenic
1103566833 12:121820288-121820310 GTGCAGCAGCATCACGATGCCGG - Intronic
1103726703 12:123000787-123000809 GTTCAGCTGCTCCACACTGGAGG + Exonic
1104209577 12:126675632-126675654 GTTCAGCAGCAGCAACATGTAGG + Intergenic
1105968388 13:25405118-25405140 GTTCAGCAGCAAGAGGCTGTTGG + Intronic
1105981963 13:25526677-25526699 GCTTAGCAGCACCATGCTGTAGG - Intronic
1106859770 13:33893162-33893184 GTTCAGCAGCACCACACCATTGG + Intronic
1106904881 13:34395402-34395424 GTTCAGCAGCACCACTCTACAGG + Intergenic
1107985879 13:45775752-45775774 CCTCATCAGCACCAAGCTGTGGG + Intergenic
1108165588 13:47689813-47689835 GTTCTGCAGCAGCACACTGGAGG + Intergenic
1108560959 13:51643536-51643558 GTTCATCAATACCACCCTGTAGG - Intronic
1108769413 13:53680266-53680288 GTTCAGCAGTACCATGCTGTAGG - Intergenic
1109362711 13:61316845-61316867 GTTCAGCAGCACCATGTGGTAGG - Intergenic
1112040115 13:95538753-95538775 GTACAGCAGGACAACGGTGTTGG - Intronic
1112480037 13:99766869-99766891 GTTTAGCAGTACCACACTATAGG - Intronic
1114655037 14:24310864-24310886 GAGCAGCAGCACCGCGCCGTCGG - Exonic
1115279675 14:31647575-31647597 GTTCAGCAGCACCACATTGTAGG - Intronic
1116514007 14:45784434-45784456 GTTTAGCAGCCCTATGCTGTAGG - Intergenic
1116745597 14:48814591-48814613 GTTCAGCAGCACTATGCTGCAGG + Intergenic
1117618067 14:57554473-57554495 GTTCAGCAGCTCCAAGCTATAGG - Intergenic
1118547346 14:66906183-66906205 GTTCAGCAGTACCACGCTGTAGG - Intronic
1125365537 15:38911479-38911501 GTTCAGCAGCAGTATGGTGTAGG - Intergenic
1126815858 15:52452561-52452583 GTTCAGCAGTATCATACTGTAGG + Intronic
1127188079 15:56500851-56500873 GTTCAGCAGCATCGTGCTGTAGG + Intergenic
1127739844 15:61892261-61892283 GTTCAGCAGCACAACACTGTGGG + Intronic
1129954015 15:79617126-79617148 GTTCAGCAGCTCCAGGATGCAGG + Intergenic
1130172966 15:81535717-81535739 GTTCAGCAGCTCCAGGCTGTAGG + Intergenic
1130484544 15:84391402-84391424 GTTCAGCAGCCCCTCTCTGCAGG + Intergenic
1131342385 15:91614501-91614523 CTTCTGCAGCCCCTCGCTGTGGG - Intergenic
1132397394 15:101483928-101483950 GTCCAGAAGCACCATGCGGTAGG + Intronic
1133125018 16:3641141-3641163 CTGCTGCAGCTCCACGCTGTGGG + Intronic
1137755985 16:50902641-50902663 GGTCAGCAACACCACCCAGTGGG - Intergenic
1139047175 16:63076056-63076078 GTTCAGCAGCACCACAGTGTAGG - Intergenic
1141568065 16:84916717-84916739 TTTCAGCAGCTCCAGGCTGCAGG + Intronic
1141783482 16:86181599-86181621 GTTCAGCAACAGCAGGCTGAGGG - Intergenic
1141858186 16:86699176-86699198 GTTCATCAGCACTAAGCTATGGG - Intergenic
1142640714 17:1284348-1284370 GTGCCGTAGCAGCACGCTGTAGG + Intronic
1143732879 17:8890894-8890916 GTTCAGCAGCAGCACGGTGCTGG + Exonic
1144233343 17:13231272-13231294 GTTCAGCACCAGCTCTCTGTGGG + Intergenic
1144762758 17:17716766-17716788 GTCCAGCAGCACCACACAGGAGG - Intronic
1145228073 17:21147856-21147878 GCTCAGCAACACAACACTGTAGG + Intronic
1148403438 17:47388031-47388053 GTTCAGCAGTACCACACTGTAGG - Intronic
1149636273 17:58172488-58172510 GTCCAGCAGCACCATGCTGTAGG + Intergenic
1149949355 17:60968732-60968754 GTTCAGCAGCACCATGTAGTAGG - Intronic
1150325931 17:64257591-64257613 GTCCAGCAGATCCACGCCGTAGG + Intronic
1151698620 17:75730930-75730952 CTCCAGCAGCTCCACGATGTTGG - Exonic
1151756690 17:76079306-76079328 GTTCAGCATTACCTTGCTGTTGG + Exonic
1152407996 17:80108374-80108396 GTACTGCTGCACCACGCTCTTGG - Intergenic
1153722606 18:7922248-7922270 GTTAAGCAGCACCTCACTGTAGG - Intronic
1155011917 18:21787319-21787341 GTTCAGCAGCACTATACTGCAGG - Intronic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1157917472 18:51680319-51680341 GTTCAGCACCACCAGGCTGTAGG + Intergenic
1159837209 18:73352708-73352730 GTTCAGCAGCAACACTCTGCAGG - Intergenic
1159906354 18:74096293-74096315 GTTCAGTAGCACCACACTACAGG + Intronic
1160429094 18:78799245-78799267 TTTCACCAGCACCACACTGCTGG + Intergenic
1161033285 19:2069891-2069913 GTGCAGCAGCACAGCGCTGACGG + Intergenic
1162265753 19:9572560-9572582 GTTCAGGAGCACCATACTGTAGG + Intronic
1164708426 19:30337252-30337274 GCTCAGCAACCCCACTCTGTGGG - Intronic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1165566185 19:36730293-36730315 GTTCAGCAGCAGCATGCTGTAGG + Intronic
1166623122 19:44322856-44322878 GTTCAGCATCACTATACTGTAGG - Intergenic
1166974736 19:46599313-46599335 GTTCGTTAGCACCATGCTGTGGG - Intronic
925418675 2:3692707-3692729 GTTCAGCAACACCATGTTGTAGG - Intronic
925628674 2:5867104-5867126 GGTCAGCAGCCCCACCCTGCTGG - Intergenic
926132469 2:10312937-10312959 GTTGAGAAGCACCATGATGTTGG - Intronic
926610848 2:14945083-14945105 GTTCAGCAGCACCAAGCTGCCGG + Intergenic
926875397 2:17471139-17471161 GTTCAGCAGCACAATGCTGTAGG - Intergenic
927523830 2:23719904-23719926 GTTAAGCAGCGCCATGCTGTAGG + Intergenic
929523208 2:42674302-42674324 GTTAAGCAGAACCACACTATGGG - Intronic
930858753 2:56047228-56047250 GTTCAGCAGCACCTTGCTGGTGG + Intergenic
931213464 2:60219676-60219698 GGTCAGAAGCAGCACGATGTTGG + Intergenic
931542067 2:63340350-63340372 ATTCAGCAGCACCACACTTTAGG - Intronic
932609056 2:73185187-73185209 GTTCAGCAGCACCATCCTCTTGG - Intergenic
932799774 2:74730796-74730818 TTAGAGCAGCACCACACTGTAGG - Intergenic
933064278 2:77773897-77773919 TTTCAGCAGCACCTCGCTCCTGG + Intergenic
933460214 2:82573659-82573681 ATTCAGCTGTACCATGCTGTAGG - Intergenic
936851567 2:116905229-116905251 ATTAAGCAGCACCATCCTGTAGG - Intergenic
938768185 2:134477820-134477842 GTACAGCTTCACCACTCTGTGGG - Intronic
939023335 2:136984192-136984214 GTACAGCTTCACCACTCTGTGGG - Intronic
939080410 2:137654297-137654319 GTTCAGCAGTACCACGCTGTAGG - Intronic
939847586 2:147267534-147267556 ATTCAGCAGCACCACACTGTAGG - Intergenic
940532013 2:154889850-154889872 GTTCGGCAGCACCACATTGTAGG - Intergenic
941360610 2:164546856-164546878 GTTCAGCAGCACCACACGATAGG + Intronic
941477870 2:165970774-165970796 GCTCACCAGCACCATGCTGTAGG + Intergenic
941589913 2:167406761-167406783 ACTCAGCAACACCATGCTGTCGG + Intergenic
943102479 2:183505172-183505194 GTTCAGCAGCATCATGCTGTTGG - Intergenic
943602563 2:189939210-189939232 TTTCAGTGGCACCATGCTGTAGG + Intronic
943659505 2:190543260-190543282 GTTCATCAGCACTGTGCTGTCGG - Intergenic
944277691 2:197858002-197858024 GTTCAACAGCCCCATGATGTAGG - Intronic
945676680 2:212863470-212863492 GTTCAGCAGCATCACCCTGTAGG - Intergenic
946926171 2:224629444-224629466 GTTCACCAGGAACACGATGTGGG - Intergenic
947305386 2:228740634-228740656 GTACAGCAGCACCATGCTCTAGG - Intergenic
948739962 2:240039849-240039871 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1171508347 20:25658171-25658193 GTTCACCAGCACCATGCTGTAGG - Intergenic
1171725518 20:28617142-28617164 GTTTATGGGCACCACGCTGTGGG - Intergenic
1171752548 20:29065943-29065965 GTTTATGGGCACCACGCTGTGGG + Intergenic
1174391536 20:50221007-50221029 ATTAAGCAGCACCACCCTGGTGG - Intergenic
1175908591 20:62393915-62393937 GTCCAGGAGCACCTGGCTGTGGG + Intronic
1178359871 21:31939854-31939876 GTTAAGCAGAACCAGGGTGTGGG - Intronic
1179451075 21:41468835-41468857 GTTCAGCAGAACCAAGCCGTTGG - Intronic
1180607975 22:17075547-17075569 GTTAAGCAGCACCATGTGGTAGG - Intergenic
1181803147 22:25360129-25360151 GTCCAGCTGCAGCACGATGTCGG + Exonic
1182815063 22:33155166-33155188 TTTCAGCAGCACCCCACTCTTGG - Intergenic
1184150628 22:42636332-42636354 GTCCAGTAGTACCAGGCTGTGGG + Intronic
1184922558 22:47615700-47615722 GTCCAGCATCTCCAGGCTGTGGG + Intergenic
952972684 3:38662633-38662655 GTTCAGCAGCAACACACTGTAGG + Intergenic
954742872 3:52768544-52768566 GTTCAGCAGCTCGCCGCTCTCGG + Exonic
955267832 3:57464298-57464320 ATTCTGCAGCACCACACTGTAGG + Intronic
955395226 3:58552470-58552492 GTTCAGCAGCACCATGCTGTAGG - Intergenic
957655641 3:83070537-83070559 GTTTACCAGTACCACACTGTAGG + Intergenic
959679826 3:109082040-109082062 GTTCAGCAGCATCACACTGCAGG + Intronic
960749171 3:120927326-120927348 GTTCAGCAGTATCATGCTATAGG - Intronic
962497928 3:135961580-135961602 GTTCAGCAGCAACATGATGTAGG - Intergenic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
963404116 3:144840659-144840681 CTTCAGCAGCATCACACTATAGG - Intergenic
964480641 3:157135059-157135081 ATTCAGCAACTCCACTCTGTGGG - Intergenic
964537124 3:157735175-157735197 GTTCAGCAGCTTCACACAGTAGG + Intergenic
964803543 3:160581213-160581235 GCTCAGCAGCAACATGCTGTAGG + Intergenic
965867386 3:173221343-173221365 GTTCAGCAGCACCATATAGTAGG - Intergenic
965884629 3:173429869-173429891 GTTCAGCAGCAACATGCTTTAGG - Intronic
967688822 3:192449461-192449483 GTTCCACAGCACCCTGCTGTCGG + Intronic
968205341 3:196794734-196794756 GTTCAGCAACACCATGTTGTAGG + Intronic
968265471 3:197359659-197359681 TTTCAGCAGCACCCCACTCTTGG - Intergenic
969473823 4:7409399-7409421 GTTCAGCAGCACCATGCTGTTGG - Intronic
970624518 4:17862101-17862123 TTTCAGCAGCACCCCACTCTTGG + Intronic
970866938 4:20770095-20770117 GTTCAGAAGAAGCAGGCTGTGGG - Intronic
971797346 4:31244696-31244718 ATTCAGCAGCACCACACTGTAGG + Intergenic
973950425 4:56007449-56007471 GTTCAGTAACAACATGCTGTAGG - Intronic
976833890 4:89348173-89348195 GTTCAGCAGTATCATGCTGTAGG - Intergenic
978888217 4:113791234-113791256 GTTCAGCAGCCCTATGCTGTAGG + Intergenic
978969068 4:114780532-114780554 GTTCAATAGCACCACACTATAGG - Intergenic
979177035 4:117678454-117678476 TTACAGCAGCACCTCGCTCTTGG - Intergenic
979380796 4:120004189-120004211 GTTCAGCAGCACCACATTATAGG + Intergenic
980066209 4:128191628-128191650 GTTCAGCAGGACCACACTGTAGG - Intronic
980868045 4:138576758-138576780 ATTCAGCAGCACCATGCTGTAGG + Intergenic
980955652 4:139426953-139426975 GGTCAGCAGGTCCACGATGTAGG + Intergenic
981159554 4:141481723-141481745 GTTCAGCAGCAGTATGCTGTAGG - Intergenic
981900692 4:149858378-149858400 ATTCAGCAGCACCATGCTGTAGG + Intergenic
983129931 4:164005775-164005797 GTTTGGCAGCACCACATTGTAGG + Intronic
983655622 4:170080587-170080609 GTTCAGCAGCACCACACTGCAGG + Intronic
983698635 4:170564315-170564337 GTTCAGCAGCACAGCTCTCTTGG + Intergenic
984379620 4:178974852-178974874 ATTCAGCAGAAGCACCCTGTTGG + Intergenic
984521249 4:180803753-180803775 TTCCAGCAGCACAATGCTGTTGG - Intergenic
985351107 4:189062225-189062247 GCTCACCAGCACCACACTGTGGG + Intergenic
986656852 5:10021301-10021323 GTTGAGCAGCACCACAACGTAGG + Intergenic
987260176 5:16195270-16195292 GATCAGCAGCATCAGTCTGTGGG + Intergenic
988412975 5:30910922-30910944 ATTCAGCAGGAACAAGCTGTTGG - Intergenic
989390339 5:40894066-40894088 ATTCAGCAGCAGCACACTATAGG - Intergenic
991011596 5:61888409-61888431 GTTCAGCAGCACCACACTTTAGG + Intergenic
992517383 5:77508803-77508825 GTACAGAAGCTTCACGCTGTGGG - Intronic
992654976 5:78900202-78900224 ATTCAGCAGCACCACACTGTAGG - Intronic
993241020 5:85385463-85385485 ATTTAGCAGCAGCATGCTGTAGG - Intergenic
993414202 5:87605843-87605865 ATTCAGCAGTACCAACCTGTAGG - Intergenic
993920063 5:93790681-93790703 GCTCAGCAGTGCCACGCTGGGGG + Intronic
993936795 5:94014183-94014205 GTTCATCAGTATCACACTGTAGG + Intronic
994317561 5:98349724-98349746 GCTTAGCAGTACCATGCTGTAGG + Intergenic
994597170 5:101854205-101854227 GTTCAGCATCAGCACACTGTAGG + Intergenic
995220265 5:109640528-109640550 TTTCAGCAGCACCTCACTCTTGG - Intergenic
995278792 5:110308861-110308883 GTTTAGCAGCACCATACTGTAGG + Intronic
995553124 5:113300016-113300038 GTGCACCAACACCATGCTGTGGG + Intronic
995827534 5:116317395-116317417 GTTCAACAGCAACATGCTGTAGG - Intronic
996113454 5:119592340-119592362 GTTCTGCAGCACCATGCTGTAGG + Intronic
997258473 5:132447234-132447256 GCTCAGCAGCCCCAAGCTATGGG + Intronic
997821478 5:137070003-137070025 TTGCAGCAGCACCTCCCTGTAGG + Intronic
998580700 5:143372416-143372438 GTTCAGCATCTCCATGCTGTAGG - Intronic
999239082 5:150117203-150117225 GTTCTTCAGCACCACGCCCTGGG - Intronic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
1000806111 5:165794824-165794846 GTTCATCAGAACCATGCTGTGGG - Intergenic
1001734046 5:173984263-173984285 CTCCAGCAGCACCACGCTATGGG + Intronic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1004009253 6:11666208-11666230 ATTCAGCAGTACCAAGATGTTGG + Intergenic
1006275330 6:33000783-33000805 CTTCAGCAGCAACAGGCTGCAGG - Intergenic
1007040805 6:38720357-38720379 GTTTGGCAGTACCATGCTGTGGG + Intronic
1009693538 6:67067104-67067126 GTCTAGCAGCACCAAGCTATAGG - Intergenic
1010295865 6:74194937-74194959 GCTGAGCAGCAACACTCTGTAGG - Intergenic
1013184005 6:107741586-107741608 GTTACGCAGTACCACACTGTAGG + Intronic
1014130789 6:117829862-117829884 CTTCAGCAGCACCACACAGTAGG + Intergenic
1015216856 6:130760076-130760098 ATTCAGCAGCACCATGCTATAGG + Intergenic
1016263771 6:142207445-142207467 GTTCAGCAGTACCATGCTGTAGG + Intronic
1016615356 6:146041622-146041644 GTTCAGCAGCACCACATTGTAGG - Intronic
1017061245 6:150487055-150487077 GTTCAGTGGCATCACGCTGGGGG + Intergenic
1017186425 6:151605412-151605434 GTTCAGCAGGACCACACTGTAGG - Intronic
1017934132 6:158989534-158989556 GTTCAGCAGCACCACATTGTAGG - Intronic
1019089949 6:169520158-169520180 GCTCAGCATCACCACACTGTAGG + Intronic
1019131338 6:169879117-169879139 GTTCAGCAGCACGAGGCTATAGG - Intergenic
1019409758 7:901346-901368 GGTCACCAGCTCCAGGCTGTAGG - Intronic
1019737305 7:2656906-2656928 GTGCAGGTGCACGACGCTGTGGG + Intronic
1020466161 7:8482101-8482123 GTTCAGCAGTTTCACTCTGTTGG - Intronic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1022443501 7:30452082-30452104 GTTCCGCTGCACCAGGCTGCTGG + Exonic
1023060327 7:36320543-36320565 TTTCAGCAGCACCCCACTGCTGG - Intergenic
1025040637 7:55641525-55641547 GTTCAGTAACACCATGCTGTAGG - Intergenic
1028560362 7:92168460-92168482 ATTCAGCAGCACCATGCTGTAGG + Intronic
1028754561 7:94420534-94420556 GTTGACCAGCAGCACCCTGTTGG - Exonic
1034087376 7:148332514-148332536 GTTCAGAAGGGCCACGCTCTGGG - Intronic
1034425261 7:151010626-151010648 GTTCCGCTGCCCCACGCTGCTGG + Exonic
1034681757 7:152934168-152934190 TTTCGGCAGCACCACAATGTCGG - Intergenic
1035986516 8:4438482-4438504 GTTCCACAGCACCTGGCTGTAGG + Intronic
1036908048 8:12724398-12724420 GTTCTTCAGAAGCACGCTGTTGG + Intronic
1037282772 8:17261814-17261836 ATTCAGCAGCTCCATGTTGTAGG - Intronic
1038347231 8:26743532-26743554 GTTTAGCAGCACCAGGTGGTTGG - Intergenic
1040774350 8:51021295-51021317 GTTCAGCATCACCATGCTATAGG + Intergenic
1041996126 8:64060515-64060537 GTTCAGGAGCACCGTTCTGTAGG + Intergenic
1043033125 8:75164249-75164271 GTTCGGCAGCACCATGCTGAAGG - Intergenic
1043063799 8:75540637-75540659 GTTTAGCCGCACAAAGCTGTTGG + Intronic
1043932672 8:86108537-86108559 GTTCAGCAGCAGCAGAGTGTGGG + Intronic
1047697886 8:127420948-127420970 GTTCATCAGCACAAAGCTGGAGG + Intergenic
1048080114 8:131117764-131117786 GTTGAGCTGCACCATGCTATAGG - Intergenic
1049953590 9:670597-670619 GTTCGGCAGCACTATGCTGTAGG - Intronic
1050580705 9:7052769-7052791 GTGCAGCAGCACCACCTCGTGGG - Intronic
1050841821 9:10158979-10159001 GTTCAGCAGCACCATGTTGTAGG + Intronic
1052689544 9:31800037-31800059 GTTCAGCAGCACCATGCTATAGG + Intergenic
1052734671 9:32328812-32328834 GTTCAGCAGCACCGTGCTGTAGG + Intergenic
1055557331 9:77488527-77488549 GTTCAGCAGCATCACTCTGTAGG + Intronic
1057296303 9:93845023-93845045 GTTCACCAGCACCATGCTGTAGG - Intergenic
1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG + Intergenic
1061323662 9:129849011-129849033 GTTCAGCAGGCCCAGGCTGCAGG - Intronic
1203451040 Un_GL000219v1:117042-117064 GTTTATGGGCACCACGCTGTGGG - Intergenic
1186994719 X:15107692-15107714 GGTCAGCAGCATCATACTGTAGG - Intergenic
1187714226 X:22086212-22086234 GTTCAGCAGCATTATGCTATAGG - Intronic
1187819837 X:23275648-23275670 GTTCAGCAGCATCAGCATGTTGG - Intergenic
1187941406 X:24386331-24386353 GTTCAGCAGCACCGTGTTGTAGG - Intergenic
1188479026 X:30618444-30618466 GCTCAGCAGCACCATGCTATAGG + Intergenic
1188903135 X:35759739-35759761 GTTCAGTAGCACCACACTGTAGG - Intergenic
1190498193 X:51047997-51048019 GTTTAACAGCACCACACAGTGGG + Intergenic
1190508151 X:51149158-51149180 GTTTAGCAGCACCACACAGTAGG - Intergenic
1192152810 X:68722565-68722587 GCTCAGCAGCATCACGCAGCAGG - Exonic
1192521931 X:71809823-71809845 GTTCAGCAGCGCCACACTGTAGG - Intergenic
1192760769 X:74094172-74094194 TTTCAGCAGCACCATGCTGGAGG + Intergenic
1193178247 X:78420874-78420896 GTTCAGCACCACCATGTTGTAGG + Intergenic
1194530037 X:95035917-95035939 GTTCATCAGCACCATGCTGTAGG - Intergenic
1194613656 X:96074847-96074869 ATTCAGCAGCATCATGTTGTAGG + Intergenic
1195073568 X:101304636-101304658 GTTCAGCAGCATCATGCTGTAGG - Intergenic
1196882779 X:120213718-120213740 GTTTAGCAGCACCACACTGTAGG + Intergenic
1196980928 X:121212942-121212964 GGTCAGCAGCACCATGCTACAGG - Intergenic
1196987106 X:121286368-121286390 GTTCGGCAGCACCACACGGTAGG - Intergenic
1197260612 X:124313209-124313231 GTTCAGCAGCACCACACTGCAGG + Intronic
1197722726 X:129755985-129756007 GCTCAGCAGCCCCACCCTGGAGG + Intronic
1199194821 X:145016010-145016032 ATTCAGCAGCACCATGCTATAGG + Intergenic
1199245045 X:145593953-145593975 GTTCAGCAGCAGCATGCTATAGG + Intergenic