ID: 1060166955

View in Genome Browser
Species Human (GRCh38)
Location 9:121425315-121425337
Sequence GTTCAGCAGCACCACGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060166952_1060166955 5 Left 1060166952 9:121425287-121425309 CCAAAGGAGATGCCAAATCAGAG No data
Right 1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG No data
1060166953_1060166955 -7 Left 1060166953 9:121425299-121425321 CCAAATCAGAGTTGCTGTTCAGC No data
Right 1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060166955 Original CRISPR GTTCAGCAGCACCACGCTGT GGG Intergenic