ID: 1060167651

View in Genome Browser
Species Human (GRCh38)
Location 9:121432240-121432262
Sequence GTGTCCTAGCAAATAACCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060167651_1060167654 -9 Left 1060167651 9:121432240-121432262 CCTGTGGTTATTTGCTAGGACAC No data
Right 1060167654 9:121432254-121432276 CTAGGACACCTATGTCCTTGGGG No data
1060167651_1060167657 5 Left 1060167651 9:121432240-121432262 CCTGTGGTTATTTGCTAGGACAC No data
Right 1060167657 9:121432268-121432290 TCCTTGGGGGAAATGTAGAATGG No data
1060167651_1060167653 -10 Left 1060167651 9:121432240-121432262 CCTGTGGTTATTTGCTAGGACAC No data
Right 1060167653 9:121432253-121432275 GCTAGGACACCTATGTCCTTGGG No data
1060167651_1060167655 -8 Left 1060167651 9:121432240-121432262 CCTGTGGTTATTTGCTAGGACAC No data
Right 1060167655 9:121432255-121432277 TAGGACACCTATGTCCTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060167651 Original CRISPR GTGTCCTAGCAAATAACCAC AGG (reversed) Intergenic
No off target data available for this crispr