ID: 1060168769

View in Genome Browser
Species Human (GRCh38)
Location 9:121443286-121443308
Sequence TCTTATCTTTACATTGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060168769_1060168772 24 Left 1060168769 9:121443286-121443308 CCATGCACAATGTAAAGATAAGA No data
Right 1060168772 9:121443333-121443355 AAACAGGGTCTCTGTTGCCCAGG 0: 8
1: 152
2: 636
3: 1384
4: 2384
1060168769_1060168773 28 Left 1060168769 9:121443286-121443308 CCATGCACAATGTAAAGATAAGA No data
Right 1060168773 9:121443337-121443359 AGGGTCTCTGTTGCCCAGGCTGG 0: 140
1: 573
2: 1676
3: 3997
4: 14283
1060168769_1060168771 9 Left 1060168769 9:121443286-121443308 CCATGCACAATGTAAAGATAAGA No data
Right 1060168771 9:121443318-121443340 ATGTTTTATTTTTTGAAACAGGG No data
1060168769_1060168770 8 Left 1060168769 9:121443286-121443308 CCATGCACAATGTAAAGATAAGA No data
Right 1060168770 9:121443317-121443339 AATGTTTTATTTTTTGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060168769 Original CRISPR TCTTATCTTTACATTGTGCA TGG (reversed) Intergenic
No off target data available for this crispr