ID: 1060168771

View in Genome Browser
Species Human (GRCh38)
Location 9:121443318-121443340
Sequence ATGTTTTATTTTTTGAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060168769_1060168771 9 Left 1060168769 9:121443286-121443308 CCATGCACAATGTAAAGATAAGA No data
Right 1060168771 9:121443318-121443340 ATGTTTTATTTTTTGAAACAGGG No data
1060168767_1060168771 13 Left 1060168767 9:121443282-121443304 CCCTCCATGCACAATGTAAAGAT No data
Right 1060168771 9:121443318-121443340 ATGTTTTATTTTTTGAAACAGGG No data
1060168768_1060168771 12 Left 1060168768 9:121443283-121443305 CCTCCATGCACAATGTAAAGATA No data
Right 1060168771 9:121443318-121443340 ATGTTTTATTTTTTGAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060168771 Original CRISPR ATGTTTTATTTTTTGAAACA GGG Intergenic
No off target data available for this crispr