ID: 1060168772

View in Genome Browser
Species Human (GRCh38)
Location 9:121443333-121443355
Sequence AAACAGGGTCTCTGTTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4564
Summary {0: 8, 1: 152, 2: 636, 3: 1384, 4: 2384}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060168768_1060168772 27 Left 1060168768 9:121443283-121443305 CCTCCATGCACAATGTAAAGATA No data
Right 1060168772 9:121443333-121443355 AAACAGGGTCTCTGTTGCCCAGG 0: 8
1: 152
2: 636
3: 1384
4: 2384
1060168769_1060168772 24 Left 1060168769 9:121443286-121443308 CCATGCACAATGTAAAGATAAGA No data
Right 1060168772 9:121443333-121443355 AAACAGGGTCTCTGTTGCCCAGG 0: 8
1: 152
2: 636
3: 1384
4: 2384
1060168767_1060168772 28 Left 1060168767 9:121443282-121443304 CCCTCCATGCACAATGTAAAGAT No data
Right 1060168772 9:121443333-121443355 AAACAGGGTCTCTGTTGCCCAGG 0: 8
1: 152
2: 636
3: 1384
4: 2384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060168772 Original CRISPR AAACAGGGTCTCTGTTGCCC AGG Intergenic
Too many off-targets to display for this crispr