ID: 1060168773

View in Genome Browser
Species Human (GRCh38)
Location 9:121443337-121443359
Sequence AGGGTCTCTGTTGCCCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 20669
Summary {0: 140, 1: 573, 2: 1676, 3: 3997, 4: 14283}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060168769_1060168773 28 Left 1060168769 9:121443286-121443308 CCATGCACAATGTAAAGATAAGA No data
Right 1060168773 9:121443337-121443359 AGGGTCTCTGTTGCCCAGGCTGG 0: 140
1: 573
2: 1676
3: 3997
4: 14283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060168773 Original CRISPR AGGGTCTCTGTTGCCCAGGC TGG Intergenic
Too many off-targets to display for this crispr