ID: 1060168773 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:121443337-121443359 |
| Sequence | AGGGTCTCTGTTGCCCAGGC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 20669 | |||
| Summary | {0: 140, 1: 573, 2: 1676, 3: 3997, 4: 14283} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1060168769_1060168773 | 28 | Left | 1060168769 | 9:121443286-121443308 | CCATGCACAATGTAAAGATAAGA | No data | ||
| Right | 1060168773 | 9:121443337-121443359 | AGGGTCTCTGTTGCCCAGGCTGG | 0: 140 1: 573 2: 1676 3: 3997 4: 14283 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1060168773 | Original CRISPR | AGGGTCTCTGTTGCCCAGGC TGG | Intergenic | ||
| Too many off-targets to display for this crispr | |||||