ID: 1060168922

View in Genome Browser
Species Human (GRCh38)
Location 9:121444418-121444440
Sequence AAGGCTTGCCCCTGAAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060168922_1060168924 -1 Left 1060168922 9:121444418-121444440 CCTGAGCTTCAGGGGCAAGCCTT No data
Right 1060168924 9:121444440-121444462 TTCCCTAATGATTCTTTCACTGG No data
1060168922_1060168927 28 Left 1060168922 9:121444418-121444440 CCTGAGCTTCAGGGGCAAGCCTT No data
Right 1060168927 9:121444469-121444491 ATTATTTCAGCGCATTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060168922 Original CRISPR AAGGCTTGCCCCTGAAGCTC AGG (reversed) Intergenic
No off target data available for this crispr