ID: 1060168924

View in Genome Browser
Species Human (GRCh38)
Location 9:121444440-121444462
Sequence TTCCCTAATGATTCTTTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060168922_1060168924 -1 Left 1060168922 9:121444418-121444440 CCTGAGCTTCAGGGGCAAGCCTT No data
Right 1060168924 9:121444440-121444462 TTCCCTAATGATTCTTTCACTGG No data
1060168918_1060168924 5 Left 1060168918 9:121444412-121444434 CCCCACCCTGAGCTTCAGGGGCA No data
Right 1060168924 9:121444440-121444462 TTCCCTAATGATTCTTTCACTGG No data
1060168921_1060168924 0 Left 1060168921 9:121444417-121444439 CCCTGAGCTTCAGGGGCAAGCCT No data
Right 1060168924 9:121444440-121444462 TTCCCTAATGATTCTTTCACTGG No data
1060168913_1060168924 13 Left 1060168913 9:121444404-121444426 CCCTGATGCCCCACCCTGAGCTT No data
Right 1060168924 9:121444440-121444462 TTCCCTAATGATTCTTTCACTGG No data
1060168920_1060168924 3 Left 1060168920 9:121444414-121444436 CCACCCTGAGCTTCAGGGGCAAG No data
Right 1060168924 9:121444440-121444462 TTCCCTAATGATTCTTTCACTGG No data
1060168912_1060168924 19 Left 1060168912 9:121444398-121444420 CCTCTGCCCTGATGCCCCACCCT No data
Right 1060168924 9:121444440-121444462 TTCCCTAATGATTCTTTCACTGG No data
1060168914_1060168924 12 Left 1060168914 9:121444405-121444427 CCTGATGCCCCACCCTGAGCTTC No data
Right 1060168924 9:121444440-121444462 TTCCCTAATGATTCTTTCACTGG No data
1060168919_1060168924 4 Left 1060168919 9:121444413-121444435 CCCACCCTGAGCTTCAGGGGCAA No data
Right 1060168924 9:121444440-121444462 TTCCCTAATGATTCTTTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060168924 Original CRISPR TTCCCTAATGATTCTTTCAC TGG Intergenic
No off target data available for this crispr