ID: 1060168927

View in Genome Browser
Species Human (GRCh38)
Location 9:121444469-121444491
Sequence ATTATTTCAGCGCATTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060168922_1060168927 28 Left 1060168922 9:121444418-121444440 CCTGAGCTTCAGGGGCAAGCCTT No data
Right 1060168927 9:121444469-121444491 ATTATTTCAGCGCATTGCTGTGG No data
1060168926_1060168927 3 Left 1060168926 9:121444443-121444465 CCTAATGATTCTTTCACTGGCAG No data
Right 1060168927 9:121444469-121444491 ATTATTTCAGCGCATTGCTGTGG No data
1060168925_1060168927 4 Left 1060168925 9:121444442-121444464 CCCTAATGATTCTTTCACTGGCA No data
Right 1060168927 9:121444469-121444491 ATTATTTCAGCGCATTGCTGTGG No data
1060168921_1060168927 29 Left 1060168921 9:121444417-121444439 CCCTGAGCTTCAGGGGCAAGCCT No data
Right 1060168927 9:121444469-121444491 ATTATTTCAGCGCATTGCTGTGG No data
1060168923_1060168927 9 Left 1060168923 9:121444437-121444459 CCTTTCCCTAATGATTCTTTCAC No data
Right 1060168927 9:121444469-121444491 ATTATTTCAGCGCATTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060168927 Original CRISPR ATTATTTCAGCGCATTGCTG TGG Intergenic
No off target data available for this crispr