ID: 1060173551

View in Genome Browser
Species Human (GRCh38)
Location 9:121480701-121480723
Sequence GGAAGACTTCTGGACCCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060173551_1060173555 5 Left 1060173551 9:121480701-121480723 CCTTTAGGGTCCAGAAGTCTTCC No data
Right 1060173555 9:121480729-121480751 CCTTGCTTAAATCCTTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060173551 Original CRISPR GGAAGACTTCTGGACCCTAA AGG (reversed) Intergenic
No off target data available for this crispr