ID: 1060179304

View in Genome Browser
Species Human (GRCh38)
Location 9:121521821-121521843
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060179298_1060179304 30 Left 1060179298 9:121521768-121521790 CCAAAAATATGGGGTTCTTAGAC No data
Right 1060179304 9:121521821-121521843 CAGCTTAGGAACCCTGTATGGGG No data
1060179299_1060179304 8 Left 1060179299 9:121521790-121521812 CCTGTGAGAAAGTGACAATCTCT No data
Right 1060179304 9:121521821-121521843 CAGCTTAGGAACCCTGTATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060179304 Original CRISPR CAGCTTAGGAACCCTGTATG GGG Intergenic
No off target data available for this crispr