ID: 1060183246

View in Genome Browser
Species Human (GRCh38)
Location 9:121548041-121548063
Sequence TACCTGCTTTTCCCTACCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060183235_1060183246 13 Left 1060183235 9:121548005-121548027 CCCACTCTCATCCCCACCCCTCT No data
Right 1060183246 9:121548041-121548063 TACCTGCTTTTCCCTACCCCTGG No data
1060183236_1060183246 12 Left 1060183236 9:121548006-121548028 CCACTCTCATCCCCACCCCTCTC No data
Right 1060183246 9:121548041-121548063 TACCTGCTTTTCCCTACCCCTGG No data
1060183237_1060183246 2 Left 1060183237 9:121548016-121548038 CCCCACCCCTCTCTGCCCCTGTC No data
Right 1060183246 9:121548041-121548063 TACCTGCTTTTCCCTACCCCTGG No data
1060183238_1060183246 1 Left 1060183238 9:121548017-121548039 CCCACCCCTCTCTGCCCCTGTCG No data
Right 1060183246 9:121548041-121548063 TACCTGCTTTTCCCTACCCCTGG No data
1060183240_1060183246 -3 Left 1060183240 9:121548021-121548043 CCCCTCTCTGCCCCTGTCGCTAC No data
Right 1060183246 9:121548041-121548063 TACCTGCTTTTCCCTACCCCTGG No data
1060183234_1060183246 28 Left 1060183234 9:121547990-121548012 CCTGTCACATACGGGCCCACTCT No data
Right 1060183246 9:121548041-121548063 TACCTGCTTTTCCCTACCCCTGG No data
1060183242_1060183246 -5 Left 1060183242 9:121548023-121548045 CCTCTCTGCCCCTGTCGCTACCT No data
Right 1060183246 9:121548041-121548063 TACCTGCTTTTCCCTACCCCTGG No data
1060183239_1060183246 0 Left 1060183239 9:121548018-121548040 CCACCCCTCTCTGCCCCTGTCGC No data
Right 1060183246 9:121548041-121548063 TACCTGCTTTTCCCTACCCCTGG No data
1060183241_1060183246 -4 Left 1060183241 9:121548022-121548044 CCCTCTCTGCCCCTGTCGCTACC No data
Right 1060183246 9:121548041-121548063 TACCTGCTTTTCCCTACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060183246 Original CRISPR TACCTGCTTTTCCCTACCCC TGG Intergenic
No off target data available for this crispr